Starting /dee2/code/volunteer_pipeline.sh SRR3207842 current disk space = 3055414849536 free memory = 1577037428 SRR3207842 SRAfilesize 080ccf7c916ea83b4a20a495384d8519 SRR3207842.sra SRR3207842.sra file validated SRR3207842 is single end SRR3207842 is conventional basespace SRR3207842 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207842_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.457 34.0 31.0 34.0 31.0 34.0 2 32.6405 34.0 31.0 34.0 31.0 34.0 3 31.52025 34.0 31.0 34.0 27.0 34.0 4 35.92075 37.0 35.0 37.0 35.0 37.0 5 36.0035 37.0 35.0 37.0 35.0 37.0 6 36.14425 37.0 36.0 37.0 35.0 37.0 7 36.13925 37.0 37.0 37.0 35.0 37.0 8 36.15425 37.0 37.0 37.0 35.0 37.0 9 37.992 39.0 38.0 39.0 35.0 39.0 10-11 37.967875 39.0 38.0 39.0 35.0 39.0 12-13 37.91475 39.0 38.0 39.0 35.0 39.0 14-15 39.4225 41.0 39.0 41.0 36.0 41.0 16-17 39.433499999999995 41.0 39.0 41.0 36.0 41.0 18-19 39.390249999999995 41.0 39.0 41.0 36.0 41.0 20-21 39.334875 41.0 39.0 41.0 36.0 41.0 22-23 39.323875 41.0 39.0 41.0 36.0 41.0 24-25 39.240624999999994 41.0 39.0 41.0 36.0 41.0 26-27 39.06925 40.0 39.0 41.0 36.0 41.0 28-29 39.00475 40.0 38.5 41.0 35.5 41.0 30-31 38.92 40.0 38.0 41.0 35.5 41.0 32-33 38.612875 40.0 38.0 41.0 34.0 41.0 34-35 38.559250000000006 40.0 38.0 41.0 34.5 41.0 36-37 38.262 40.0 38.0 41.0 34.0 41.0 38-39 38.283875 40.0 38.0 41.0 34.0 41.0 40-41 38.250375 40.0 38.0 41.0 33.5 41.0 42-43 38.299875 40.0 38.0 41.0 34.0 41.0 44-45 38.173875 40.0 38.0 41.0 33.5 41.0 46-47 38.061875 40.0 38.0 41.0 33.0 41.0 48-49 37.679 40.0 37.5 41.0 33.0 41.0 50-51 37.641125 40.0 37.0 41.0 32.5 41.0 52-53 38.057625 40.0 38.0 41.0 33.5 41.0 54-55 38.1395 40.0 38.0 41.0 34.0 41.0 56-57 37.938125 40.0 37.5 41.0 33.0 41.0 58-59 37.700374999999994 40.0 37.0 41.0 32.5 41.0 60-61 37.44 40.0 37.0 41.0 32.0 41.0 62-63 37.177125000000004 39.0 36.0 41.0 32.0 41.0 64-65 36.964875 39.0 36.0 41.0 31.5 41.0 66-67 36.67875 38.5 35.5 40.5 32.0 41.0 68-69 36.173125 37.5 35.0 40.0 31.0 41.0 70-71 35.736375 37.0 35.0 39.0 31.0 41.0 72-73 35.256249999999994 36.5 35.0 39.0 30.5 41.0 74-75 34.74825 36.0 34.0 38.5 29.5 39.5 76-77 33.172625 34.5 32.0 36.5 27.5 39.0 78-79 33.79774999999999 35.0 34.0 37.0 29.0 39.0 80-81 33.705749999999995 35.0 34.0 36.5 29.0 38.0 82-83 33.401375 35.0 34.0 36.0 29.0 37.0 84-85 33.159625000000005 35.0 34.0 36.0 29.0 37.0 86-87 32.852625 35.0 34.0 35.0 29.0 36.5 88-89 32.621625 35.0 34.0 35.0 29.0 36.0 90-91 32.4065 35.0 33.0 35.0 28.0 36.0 92-93 32.210499999999996 35.0 33.0 35.0 27.0 36.0 94-95 31.997999999999998 35.0 33.0 35.0 27.0 35.0 96-97 31.72475 35.0 33.0 35.0 25.5 35.0 98-99 31.5745 35.0 33.0 35.0 25.0 35.0 100 31.3975 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 2.0 11 3.0 12 5.0 13 6.0 14 1.0 15 6.0 16 10.0 17 6.0 18 9.0 19 8.0 20 1.0 21 10.0 22 13.0 23 12.0 24 9.0 25 19.0 26 23.0 27 30.0 28 41.0 29 36.0 30 47.0 31 68.0 32 94.0 33 133.0 34 167.0 35 216.0 36 413.0 37 900.0 38 1422.0 39 287.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.29847002758967 14.798093804865815 12.841735640832704 42.06170052671182 2 20.025000000000002 22.2 34.975 22.8 3 21.85 25.15 25.900000000000002 27.1 4 25.45 31.8 20.474999999999998 22.275 5 24.275 35.3 22.475 17.95 6 18.479619904976243 38.25956489122281 24.90622655663916 18.35458864716179 7 17.325 19.225 42.199999999999996 21.25 8 19.425 24.275 31.225 25.074999999999996 9 20.0 24.474999999999998 31.900000000000002 23.625 10-11 22.825 34.875 22.3125 19.9875 12-13 20.95 26.724999999999998 29.549999999999997 22.775000000000002 14-15 22.0875 27.3 28.725 21.8875 16-17 22.3 28.275 27.3625 22.0625 18-19 21.6 28.8375 27.05 22.5125 20-21 21.625 29.1375 27.825 21.4125 22-23 22.45 28.787499999999998 26.450000000000003 22.3125 24-25 22.225 28.725 27.6875 21.3625 26-27 22.7625 28.625 27.1625 21.45 28-29 21.55 27.975 28.1 22.375 30-31 21.7875 28.575 27.275 22.3625 32-33 21.375 27.9375 28.749999999999996 21.9375 34-35 22.05 28.199999999999996 27.625 22.125 36-37 21.987499999999997 27.375 28.3125 22.325 38-39 22.400000000000002 28.525 27.35 21.725 40-41 21.425 27.725 28.3375 22.5125 42-43 22.4375 27.762500000000003 27.875 21.925 44-45 22.037499999999998 27.8375 28.237499999999997 21.8875 46-47 22.4375 27.6875 27.825 22.05 48-49 22.67267267267267 27.89039039039039 26.901901901901905 22.535035035035033 50-51 22.097097097097095 28.503503503503502 28.003003003003002 21.396396396396398 52-53 22.8125 28.0875 26.924999999999997 22.175 54-55 21.7 28.6625 27.250000000000004 22.3875 56-57 21.7875 28.4375 27.8625 21.912499999999998 58-59 22.0625 28.349999999999998 26.787499999999998 22.8 60-61 21.525 28.3375 27.875 22.2625 62-63 21.65 27.825 27.5625 22.9625 64-65 22.3625 28.1375 27.5125 21.987499999999997 66-67 22.625 27.85 27.3875 22.1375 68-69 21.712500000000002 28.375 27.762500000000003 22.15 70-71 22.95 27.712500000000002 27.1625 22.175 72-73 21.2875 27.8125 28.4375 22.4625 74-75 22.00275034379297 28.253531691461433 27.640955119389925 22.10276284535567 76-77 22.408403151181695 28.785794673002375 27.097661623108664 21.708140552707263 78-79 22.0 26.9625 28.775000000000002 22.2625 80-81 21.825 28.000000000000004 27.875 22.3 82-83 21.475 27.8375 28.525 22.162499999999998 84-85 21.7 27.675 28.487499999999997 22.1375 86-87 22.225 29.2 27.6 20.974999999999998 88-89 22.375 28.0875 26.7625 22.775000000000002 90-91 21.2875 28.287499999999998 28.425 22.0 92-93 21.987499999999997 28.249999999999996 27.2625 22.5 94-95 23.1 27.575 27.537499999999998 21.7875 96-97 23.4875 27.125 27.950000000000003 21.4375 98-99 22.125 29.1875 27.474999999999998 21.212500000000002 100 23.3 27.150000000000002 28.025 21.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 3.0 26 4.5 27 4.0 28 5.5 29 9.0 30 11.0 31 14.5 32 24.0 33 39.5 34 48.0 35 64.5 36 94.5 37 114.0 38 127.0 39 165.0 40 200.5 41 207.0 42 238.0 43 278.0 44 294.0 45 289.0 46 274.5 47 253.0 48 227.5 49 194.5 50 175.5 51 147.5 52 109.0 53 93.5 54 68.5 55 46.0 56 35.5 57 30.5 58 23.0 59 13.0 60 10.5 61 11.5 62 10.0 63 7.0 64 4.0 65 4.0 66 5.0 67 4.0 68 3.5 69 3.0 70 2.0 71 1.0 72 1.0 73 1.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.1 50-51 0.1 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0375 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra Read 1000846 spots for SRR3207842.sra Written 1000846 spots for SRR3207842.sra Read 1000845 spots for SRR3207842.sra Written 1000845 spots for SRR3207842.sra SRR ids: ['SRR3207842.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lp182qia SRR3207842.sra spots: 20016901 blocks: [[1, 1000845], [1000846, 2001690], [2001691, 3002535], [3002536, 4003380], [4003381, 5004225], [5004226, 6005070], [6005071, 7005915], [7005916, 8006760], [8006761, 9007605], [9007606, 10008450], [10008451, 11009295], [11009296, 12010140], [12010141, 13010985], [13010986, 14011830], [14011831, 15012675], [15012676, 16013520], [16013521, 17014365], [17014366, 18015210], [18015211, 19016055], [19016056, 20016901]] SRR3207842 file size 5208852 SRR3207842 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207842 SRR3207842_1.fastq Input file: SRR3207842_1.fastq trimmed: SRR3207842-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:08:16 2025 >> started Tue Feb 11 09:08:26 2025 >> done (9.844s) 20016901 reads processed; of these: 1846 ( 0.01%) short reads filtered out after trimming by size control 4618 ( 0.02%) empty reads filtered out after trimming by size control 20010437 (99.97%) reads available; of these: 1381345 ( 6.90%) trimmed reads available after processing 18629092 (93.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 453 0.00% 19 568 0.00% 20 738 0.00% 21 1009 0.01% 22 1304 0.01% 23 1938 0.01% 24 2551 0.01% 25 3303 0.02% 26 3396 0.02% 27 3425 0.02% 28 3507 0.02% 29 3780 0.02% 30 3904 0.02% 31 3831 0.02% 32 4098 0.02% 33 4126 0.02% 34 4394 0.02% 35 4548 0.02% 36 4798 0.02% 37 4874 0.02% 38 4983 0.02% 39 5457 0.03% 40 5402 0.03% 41 5531 0.03% 42 5540 0.03% 43 6001 0.03% 44 6096 0.03% 45 6507 0.03% 46 6667 0.03% 47 6907 0.03% 48 6814 0.03% 49 6612 0.03% 50 6541 0.03% 51 6799 0.03% 52 6916 0.03% 53 7279 0.04% 54 7726 0.04% 55 7936 0.04% 56 8279 0.04% 57 8578 0.04% 58 8730 0.04% 59 9004 0.04% 60 9176 0.05% 61 9242 0.05% 62 9606 0.05% 63 9888 0.05% 64 9883 0.05% 65 10660 0.05% 66 11526 0.06% 67 11566 0.06% 68 11652 0.06% 69 12184 0.06% 70 12801 0.06% 71 13756 0.07% 72 13670 0.07% 73 14596 0.07% 74 15347 0.08% 75 15915 0.08% 76 9153 0.05% 77 10467 0.05% 78 12338 0.06% 79 13952 0.07% 80 15316 0.08% 81 16290 0.08% 82 17461 0.09% 83 18572 0.09% 84 19675 0.10% 85 20834 0.10% 86 22395 0.11% 87 24471 0.12% 88 26667 0.13% 89 29149 0.15% 90 33081 0.17% 91 37147 0.19% 92 43165 0.22% 93 49594 0.25% 94 58169 0.29% 95 70501 0.35% 96 84680 0.42% 97 99984 0.50% 98 117764 0.59% 99 128202 0.64% 100 18629092 93.10% 20010437 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=89.08 fanout-score-rank=10 prefix-density=0.41 prefix-fanout=35.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=302.63 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.3 sequence=TTCTTCTTCTTT Started job on | Feb 11 09:08:42 Started mapping on | Feb 11 09:08:42 Finished on | Feb 11 09:09:05 Mapping speed, Million of reads per hour | 3132.07 Number of input reads | 20010437 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19106147 Uniquely mapped reads % | 95.48% Average mapped length | 98.29 Number of splices: Total | 5483595 Number of splices: Annotated (sjdb) | 5377067 Number of splices: GT/AG | 5395281 Number of splices: GC/AG | 71928 Number of splices: AT/AC | 5758 Number of splices: Non-canonical | 10628 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 500954 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 113948 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.44% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 403336 403336 403336 N_multimapping 500954 500954 500954 N_noFeature 782478 9808551 9954259 N_ambiguous 191464 33073 32906 UnstrandedReadsAssigned:18132205 PositiveStrandReadsAssigned:9264523 NegativeStrandReadsAssigned:9118982 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207842 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207842-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,010,437 reads, 18,645,691 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR3207842.ke.tsv 34699 SRR3207842.se.tsv 87100 total ==> SRR3207842.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 801 32.3062 Potri.005G024800.1.v4.1 1035 936 143 11.8247 Potri.004G059700.1.v4.1 961 862 18 1.6162 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 456.89 12.434 Potri.016G087400.1.v4.1 270 171 952 430.893 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 90.4955 4.18408 Potri.012G127500.1.v4.1 977 878 3836 338.153 ==> SRR3207842.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1831 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 343 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207842 completed mapping pipeline successfully