Starting /dee2/code/volunteer_pipeline.sh SRR3207843 current disk space = 3055726923776 free memory = 1514742688 SRR3207843 SRAfilesize 651b51a54e45415cf7c5b4714623c8aa SRR3207843.sra SRR3207843.sra file validated SRR3207843 is single end SRR3207843 is conventional basespace SRR3207843 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207843_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49325 34.0 31.0 34.0 31.0 34.0 2 32.88375 34.0 33.0 34.0 31.0 34.0 3 33.13925 34.0 34.0 34.0 31.0 34.0 4 36.5235 37.0 37.0 37.0 35.0 37.0 5 36.4505 37.0 37.0 37.0 35.0 37.0 6 36.46475 37.0 37.0 37.0 35.0 37.0 7 36.442 37.0 37.0 37.0 35.0 37.0 8 36.4475 37.0 37.0 37.0 35.0 37.0 9 38.15575 39.0 39.0 39.0 37.0 39.0 10-11 38.296375 39.0 39.0 39.0 37.0 39.0 12-13 38.22475 39.0 39.0 39.0 37.0 39.0 14-15 39.826125000000005 41.0 40.0 41.0 38.0 41.0 16-17 39.8105 41.0 40.0 41.0 38.0 41.0 18-19 39.766875 41.0 40.0 41.0 37.5 41.0 20-21 39.745375 41.0 40.0 41.0 37.0 41.0 22-23 39.71075 41.0 40.0 41.0 37.0 41.0 24-25 39.635 41.0 40.0 41.0 37.0 41.0 26-27 39.581500000000005 41.0 40.0 41.0 37.0 41.0 28-29 39.5225 41.0 39.0 41.0 37.0 41.0 30-31 39.315625 41.0 39.0 41.0 36.0 41.0 32-33 39.31125 40.0 39.0 41.0 36.5 41.0 34-35 39.23675 40.0 39.0 41.0 36.0 41.0 36-37 39.032 40.0 38.5 41.0 35.5 41.0 38-39 38.87425 40.0 38.0 41.0 35.0 41.0 40-41 38.75 40.0 38.0 41.0 35.0 41.0 42-43 38.848 40.0 38.0 41.0 35.0 41.0 44-45 38.60575 40.0 38.0 41.0 34.5 41.0 46-47 38.673125 40.0 38.0 41.0 35.0 41.0 48-49 38.483374999999995 40.0 38.0 41.0 34.5 41.0 50-51 38.406625000000005 40.0 38.0 41.0 34.0 41.0 52-53 38.732375000000005 40.0 38.0 41.0 35.0 41.0 54-55 38.746125 40.0 38.0 41.0 35.0 41.0 56-57 38.612750000000005 40.0 38.0 41.0 34.5 41.0 58-59 38.342124999999996 40.0 38.0 41.0 34.0 41.0 60-61 38.114000000000004 40.0 37.0 41.0 34.0 41.0 62-63 37.649874999999994 39.5 36.5 41.0 32.5 41.0 64-65 37.497749999999996 39.0 36.0 41.0 33.0 41.0 66-67 37.300375 39.0 36.0 41.0 33.0 41.0 68-69 36.94325 38.5 35.0 40.5 32.5 41.0 70-71 36.49975 37.0 35.0 40.0 32.0 41.0 72-73 36.027125 37.0 35.0 39.0 32.0 41.0 74-75 35.536 36.5 35.0 39.0 31.5 40.5 76-77 34.20375 35.0 33.5 37.0 29.5 39.0 78-79 34.513125 35.0 34.0 37.0 30.5 39.0 80-81 34.445875 35.0 34.0 37.0 31.0 38.5 82-83 34.144999999999996 35.0 34.0 36.0 31.0 37.0 84-85 33.877875 35.0 34.0 36.0 31.0 37.0 86-87 33.518 35.0 34.0 35.5 30.5 36.5 88-89 33.280625 35.0 34.0 35.0 29.5 36.0 90-91 33.147125 35.0 34.0 35.0 30.0 36.0 92-93 33.066 35.0 34.0 35.0 30.0 36.0 94-95 32.8505 35.0 34.0 35.0 30.0 35.5 96-97 32.461625 35.0 34.0 35.0 29.0 35.0 98-99 32.372125 35.0 34.0 35.0 29.0 35.0 100 32.325 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 2.0 13 4.0 14 1.0 15 4.0 16 3.0 17 6.0 18 6.0 19 8.0 20 3.0 21 1.0 22 4.0 23 4.0 24 6.0 25 16.0 26 18.0 27 22.0 28 24.0 29 35.0 30 34.0 31 51.0 32 68.0 33 89.0 34 144.0 35 174.0 36 342.0 37 909.0 38 1605.0 39 415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.777862401624777 14.953033764914952 16.450875856816452 43.81822797664382 2 19.25 23.1 38.025 19.625 3 21.725 26.224999999999998 28.025 24.025 4 24.4 33.425 20.95 21.224999999999998 5 23.525 35.449999999999996 22.75 18.275 6 18.3 37.5 23.974999999999998 20.225 7 17.2 17.224999999999998 45.15 20.424999999999997 8 20.200000000000003 22.525000000000002 29.175 28.1 9 19.525000000000002 23.35 31.275 25.85 10-11 22.8375 33.5125 22.45 21.2 12-13 20.0625 26.150000000000002 30.7 23.0875 14-15 21.087500000000002 27.737499999999997 28.875 22.3 16-17 22.662499999999998 27.462500000000002 27.450000000000003 22.425 18-19 22.9625 28.249999999999996 27.237499999999997 21.55 20-21 22.412499999999998 28.3375 27.425 21.825 22-23 22.0 28.075 27.9375 21.987499999999997 24-25 21.512500000000003 28.799999999999997 28.287499999999998 21.4 26-27 22.275 28.549999999999997 27.450000000000003 21.725 28-29 21.987499999999997 28.6375 27.500000000000004 21.875 30-31 22.287499999999998 28.299999999999997 26.724999999999998 22.6875 32-33 21.337500000000002 28.875 27.8625 21.925 34-35 21.3125 28.1875 28.299999999999997 22.2 36-37 22.2 28.449999999999996 27.450000000000003 21.9 38-39 22.35 28.799999999999997 27.5125 21.337500000000002 40-41 22.412499999999998 27.962500000000002 27.400000000000002 22.225 42-43 21.8 28.599999999999998 27.962500000000002 21.637500000000003 44-45 21.25 27.6625 28.249999999999996 22.8375 46-47 22.3875 28.449999999999996 27.750000000000004 21.4125 48-49 20.980245061265315 28.619654913728432 28.169542385596397 22.230557639409852 50-51 21.658121795673377 27.5728398149306 28.323121170438913 22.44591721895711 52-53 21.540192524065507 28.30353794224278 27.678459807475935 22.477809726215778 54-55 21.4375 29.45 26.5625 22.55 56-57 21.6625 28.537499999999998 28.1375 21.6625 58-59 21.675 28.5625 28.212500000000002 21.55 60-61 21.575 29.375 26.9625 22.0875 62-63 21.125 29.037499999999998 28.15 21.6875 64-65 22.1 27.800000000000004 28.849999999999998 21.25 66-67 22.35 28.549999999999997 27.0875 22.0125 68-69 22.0 29.075 27.8375 21.087500000000002 70-71 23.075000000000003 28.4375 26.8125 21.675 72-73 22.05 28.5875 27.325 22.037499999999998 74-75 22.25834688008003 29.298486932599726 27.49781167937977 20.94535450794048 76-77 22.02351175587794 28.62681340670335 27.688844422211105 21.660830415207606 78-79 22.493123280820203 28.532133033258315 27.94448612153038 21.030257564391096 80-81 22.6875 28.15 27.500000000000004 21.6625 82-83 22.2 28.225 28.625 20.95 84-85 22.425 28.225 27.750000000000004 21.6 86-87 21.925 27.8625 28.349999999999998 21.8625 88-89 22.125 27.487499999999997 27.6 22.787499999999998 90-91 21.762500000000003 27.875 28.1375 22.225 92-93 23.075000000000003 27.8125 27.0125 22.1 94-95 21.762500000000003 28.225 28.4125 21.6 96-97 22.5875 28.8875 27.437499999999996 21.087500000000002 98-99 22.5625 27.750000000000004 28.799999999999997 20.8875 100 22.525000000000002 28.225 27.450000000000003 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 3.0 26 7.0 27 7.5 28 8.0 29 13.0 30 22.5 31 32.5 32 36.0 33 39.0 34 57.0 35 78.0 36 95.0 37 121.5 38 140.0 39 156.0 40 185.5 41 211.5 42 237.0 43 259.5 44 271.5 45 278.5 46 286.0 47 267.0 48 216.5 49 193.0 50 169.5 51 132.5 52 104.5 53 87.5 54 70.0 55 49.0 56 37.0 57 26.0 58 20.5 59 18.5 60 15.5 61 10.5 62 7.5 63 4.5 64 2.5 65 3.0 66 2.5 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 1.0 74 1.5 75 1.0 76 2.0 77 1.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.025 50-51 0.0375 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0375 76-77 0.05 78-79 0.025 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.037500000000000006 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873305 spots for SRR3207843.sra Written 873305 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra Read 873301 spots for SRR3207843.sra Written 873301 spots for SRR3207843.sra SRR ids: ['SRR3207843.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x89ptetd SRR3207843.sra spots: 17466024 blocks: [[1, 873301], [873302, 1746602], [1746603, 2619903], [2619904, 3493204], [3493205, 4366505], [4366506, 5239806], [5239807, 6113107], [6113108, 6986408], [6986409, 7859709], [7859710, 8733010], [8733011, 9606311], [9606312, 10479612], [10479613, 11352913], [11352914, 12226214], [12226215, 13099515], [13099516, 13972816], [13972817, 14846117], [14846118, 15719418], [15719419, 16592719], [16592720, 17466024]] SRR3207843 file size 4543757 SRR3207843 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207843 SRR3207843_1.fastq Input file: SRR3207843_1.fastq trimmed: SRR3207843-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 08:37:52 2025 >> started Tue Feb 11 08:38:03 2025 >> done (10.894s) 17466024 reads processed; of these: 2413 ( 0.01%) short reads filtered out after trimming by size control 4541 ( 0.03%) empty reads filtered out after trimming by size control 17459070 (99.96%) reads available; of these: 943641 ( 5.40%) trimmed reads available after processing 16515429 (94.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 411 0.00% 19 490 0.00% 20 558 0.00% 21 838 0.00% 22 1112 0.01% 23 1708 0.01% 24 2185 0.01% 25 2875 0.02% 26 2732 0.02% 27 2672 0.02% 28 2843 0.02% 29 2812 0.02% 30 2851 0.02% 31 3054 0.02% 32 3361 0.02% 33 3177 0.02% 34 3288 0.02% 35 3475 0.02% 36 3699 0.02% 37 3806 0.02% 38 3939 0.02% 39 3911 0.02% 40 4143 0.02% 41 4275 0.02% 42 4274 0.02% 43 4492 0.03% 44 4625 0.03% 45 4874 0.03% 46 5005 0.03% 47 5282 0.03% 48 5017 0.03% 49 4949 0.03% 50 4842 0.03% 51 4840 0.03% 52 5028 0.03% 53 5151 0.03% 54 5593 0.03% 55 5720 0.03% 56 5962 0.03% 57 6627 0.04% 58 6626 0.04% 59 6469 0.04% 60 6758 0.04% 61 6960 0.04% 62 6893 0.04% 63 6799 0.04% 64 6963 0.04% 65 7338 0.04% 66 8148 0.05% 67 7881 0.05% 68 8087 0.05% 69 8415 0.05% 70 8853 0.05% 71 9303 0.05% 72 9985 0.06% 73 10478 0.06% 74 10895 0.06% 75 10884 0.06% 76 6217 0.04% 77 7127 0.04% 78 8457 0.05% 79 9735 0.06% 80 10248 0.06% 81 11021 0.06% 82 11711 0.07% 83 12813 0.07% 84 13079 0.07% 85 14392 0.08% 86 15061 0.09% 87 16702 0.10% 88 18694 0.11% 89 20226 0.12% 90 21961 0.13% 91 24919 0.14% 92 28299 0.16% 93 32724 0.19% 94 37856 0.22% 95 46636 0.27% 96 55901 0.32% 97 65316 0.37% 98 76896 0.44% 99 83419 0.48% 100 16515429 94.60% 17459070 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=87.94 fanout-score-rank=7 prefix-density=0.55 prefix-fanout=35.8 sequence=AGATCGGAAGAGCACACGTCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=303.17 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 08:38:19 Started mapping on | Feb 11 08:38:20 Finished on | Feb 11 08:38:42 Mapping speed, Million of reads per hour | 2856.94 Number of input reads | 17459070 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 16735345 Uniquely mapped reads % | 95.85% Average mapped length | 98.58 Number of splices: Total | 4986385 Number of splices: Annotated (sjdb) | 4893511 Number of splices: GT/AG | 4908180 Number of splices: GC/AG | 64496 Number of splices: AT/AC | 4987 Number of splices: Non-canonical | 8722 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 1.91 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425671 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 202604 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298054 298054 298054 N_multimapping 425671 425671 425671 N_noFeature 714812 8626372 8723117 N_ambiguous 158216 28613 29171 UnstrandedReadsAssigned:15862317 PositiveStrandReadsAssigned:8080360 NegativeStrandReadsAssigned:7983057 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207843 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207843-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,459,070 reads, 16,362,526 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,251 rounds 52401 SRR3207843.ke.tsv 34699 SRR3207843.se.tsv 87100 total ==> SRR3207843.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 671 31.7541 Potri.005G024800.1.v4.1 1035 936 165 16.0089 Potri.004G059700.1.v4.1 961 862 13 1.36958 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 382.492 12.2136 Potri.016G087400.1.v4.1 270 171 737 391.402 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 85 4.61122 Potri.012G127500.1.v4.1 977 878 2657 274.821 ==> SRR3207843.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1590 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 307 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207843 completed mapping pipeline successfully