Starting /dee2/code/volunteer_pipeline.sh SRR3207844 current disk space = 3055536889856 free memory = 1580219864 SRR3207844 SRAfilesize 008711098c96397272ac574ad07a33c6 SRR3207844.sra SRR3207844.sra file validated SRR3207844 is single end SRR3207844 is conventional basespace SRR3207844 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207844_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69475 34.0 31.0 34.0 31.0 34.0 2 32.446 34.0 31.0 34.0 31.0 34.0 3 32.9245 34.0 33.0 34.0 31.0 34.0 4 36.42125 37.0 37.0 37.0 35.0 37.0 5 36.38675 37.0 37.0 37.0 35.0 37.0 6 36.4325 37.0 37.0 37.0 35.0 37.0 7 36.35225 37.0 37.0 37.0 35.0 37.0 8 36.377 37.0 37.0 37.0 35.0 37.0 9 38.16275 39.0 39.0 39.0 37.0 39.0 10-11 38.207625 39.0 39.0 39.0 37.0 39.0 12-13 38.165625000000006 39.0 39.0 39.0 37.0 39.0 14-15 39.733875 41.0 40.0 41.0 37.0 41.0 16-17 39.73425 41.0 40.0 41.0 37.0 41.0 18-19 39.591750000000005 41.0 40.0 41.0 37.0 41.0 20-21 39.588 41.0 40.0 41.0 37.0 41.0 22-23 39.581625 41.0 40.0 41.0 37.0 41.0 24-25 39.530874999999995 41.0 40.0 41.0 37.0 41.0 26-27 39.422125 41.0 39.0 41.0 36.5 41.0 28-29 39.32175 41.0 39.0 41.0 36.5 41.0 30-31 39.083375000000004 40.5 39.0 41.0 36.0 41.0 32-33 39.141625000000005 40.0 39.0 41.0 36.0 41.0 34-35 39.023375 40.0 39.0 41.0 36.0 41.0 36-37 38.823375 40.0 38.5 41.0 35.0 41.0 38-39 38.637625 40.0 38.0 41.0 34.5 41.0 40-41 38.600875 40.0 38.0 41.0 34.5 41.0 42-43 38.633125 40.0 38.0 41.0 35.0 41.0 44-45 38.506625 40.0 38.0 41.0 34.5 41.0 46-47 38.342 40.0 38.0 41.0 34.0 41.0 48-49 38.066 40.0 38.0 41.0 33.0 41.0 50-51 38.060375 40.0 38.0 41.0 33.0 41.0 52-53 38.39525 40.0 38.0 41.0 34.0 41.0 54-55 38.454375 40.0 38.0 41.0 34.0 41.0 56-57 38.358875 40.0 38.0 41.0 34.5 41.0 58-59 38.04325 40.0 37.0 41.0 34.0 41.0 60-61 37.806375 40.0 37.0 41.0 34.0 41.0 62-63 37.436 39.0 36.0 41.0 33.0 41.0 64-65 37.116749999999996 39.0 36.0 41.0 32.0 41.0 66-67 36.89675 39.0 35.5 40.5 32.0 41.0 68-69 36.57 37.5 35.0 40.0 32.0 41.0 70-71 36.065 37.0 35.0 39.5 32.0 41.0 72-73 35.579125000000005 36.5 35.0 39.0 31.0 41.0 74-75 35.0945 36.0 35.0 39.0 31.0 39.5 76-77 33.753125 35.0 33.5 37.0 29.5 39.0 78-79 34.067375 35.0 34.0 37.0 30.0 39.0 80-81 33.896 35.0 34.0 36.5 30.0 38.0 82-83 33.6605 35.0 34.0 36.0 30.0 37.0 84-85 33.4455 35.0 34.0 36.0 30.0 37.0 86-87 33.176375 35.0 34.0 35.5 29.5 36.5 88-89 32.856625 35.0 34.0 35.0 29.0 36.0 90-91 32.766375 35.0 34.0 35.0 29.0 36.0 92-93 32.64 35.0 34.0 35.0 29.0 36.0 94-95 32.489625000000004 35.0 34.0 35.0 29.0 35.5 96-97 32.20575 35.0 34.0 35.0 28.5 35.0 98-99 32.064625 35.0 33.5 35.0 28.0 35.0 100 31.94 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 1.0 9 0.0 10 3.0 11 4.0 12 2.0 13 2.0 14 5.0 15 3.0 16 4.0 17 9.0 18 6.0 19 9.0 20 2.0 21 7.0 22 10.0 23 16.0 24 14.0 25 8.0 26 20.0 27 27.0 28 23.0 29 39.0 30 39.0 31 55.0 32 69.0 33 105.0 34 118.0 35 223.0 36 343.0 37 928.0 38 1556.0 39 347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.13972888425443 14.468196037539101 16.579770594369133 44.81230448383733 2 19.675 21.525 37.85 20.95 3 22.775000000000002 24.95 26.125 26.150000000000002 4 24.9 31.874999999999996 20.225 23.0 5 24.349999999999998 35.5 21.725 18.425 6 19.2 36.25 24.725 19.825 7 16.950000000000003 17.424999999999997 44.125 21.5 8 18.825 23.075000000000003 29.975 28.125 9 20.674999999999997 22.400000000000002 32.15 24.775 10-11 23.1375 32.887499999999996 22.4375 21.5375 12-13 21.224999999999998 26.0125 29.099999999999998 23.6625 14-15 21.45 26.9625 29.325000000000003 22.2625 16-17 22.425 28.199999999999996 27.275 22.1 18-19 21.7875 28.749999999999996 25.687500000000004 23.775 20-21 22.175 28.6875 26.337500000000002 22.8 22-23 21.337500000000002 28.749999999999996 26.974999999999998 22.9375 24-25 22.3375 27.55 27.075 23.0375 26-27 22.2625 28.9375 26.75 22.05 28-29 22.400000000000002 27.6625 27.237499999999997 22.7 30-31 22.1 27.3875 27.6625 22.85 32-33 22.287499999999998 27.85 27.5875 22.275 34-35 22.287499999999998 27.500000000000004 28.037499999999998 22.175 36-37 22.375 28.475 26.275 22.875 38-39 22.6875 27.8375 27.6625 21.8125 40-41 22.912499999999998 28.5875 26.3125 22.1875 42-43 22.4875 29.262500000000003 26.6125 21.637500000000003 44-45 23.0125 26.8625 27.5125 22.6125 46-47 22.7625 27.3875 27.6625 22.1875 48-49 22.540317539692463 27.390923865483185 27.428428553569194 22.640330041255158 50-51 22.505945675303543 27.913380898735763 27.98848416572788 21.592189260232818 52-53 22.043010752688172 27.93198299574894 27.369342335583895 22.655663915978995 54-55 21.825 28.0875 27.762500000000003 22.325 56-57 23.0125 27.2625 27.3125 22.412499999999998 58-59 21.5375 28.3875 28.5875 21.4875 60-61 23.0875 27.125 27.9125 21.875 62-63 22.9375 26.787499999999998 27.925 22.35 64-65 21.85 27.8375 28.075 22.237499999999997 66-67 22.275 27.6875 26.700000000000003 23.3375 68-69 21.825 27.675 27.287499999999998 23.2125 70-71 21.85 28.499999999999996 27.0 22.650000000000002 72-73 21.55 27.8375 28.037499999999998 22.575 74-75 22.751719824890557 27.054409005628514 27.904940587867415 22.28893058161351 76-77 22.761988230875172 27.45711781645173 27.845248528859397 21.935645423813696 78-79 21.842960740185045 27.68192048012003 27.806951737934483 22.66816704176044 80-81 22.2 26.674999999999997 28.4375 22.6875 82-83 22.237499999999997 28.825 27.525 21.4125 84-85 22.8625 28.1875 28.3375 20.6125 86-87 22.225 28.1875 27.8375 21.75 88-89 22.237499999999997 27.987499999999997 27.35 22.425 90-91 22.75 27.6625 27.05 22.537499999999998 92-93 21.224999999999998 28.4125 27.762500000000003 22.6 94-95 23.0 28.025 27.500000000000004 21.475 96-97 22.85 27.825 27.6 21.725 98-99 22.7625 27.375 28.725 21.1375 100 23.599999999999998 27.0 26.724999999999998 22.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.0 27 2.0 28 3.0 29 7.0 30 14.0 31 16.5 32 21.5 33 31.0 34 38.5 35 60.0 36 90.0 37 111.0 38 132.0 39 172.5 40 211.5 41 225.0 42 231.5 43 246.5 44 274.5 45 275.5 46 255.0 47 254.5 48 234.0 49 191.5 50 160.0 51 132.0 52 116.0 53 106.5 54 83.0 55 56.0 56 40.5 57 37.5 58 36.0 59 25.5 60 18.0 61 13.5 62 12.5 63 10.5 64 6.5 65 6.0 66 4.5 67 5.5 68 4.5 69 2.0 70 1.5 71 2.0 72 1.5 73 1.5 74 1.5 75 0.5 76 0.5 77 1.0 78 1.5 79 1.0 80 0.0 81 1.0 82 2.0 83 1.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.1000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.13749999999999998 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0625 76-77 0.1625 78-79 0.025 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.037500000000000006 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354573 spots for SRR3207844.sra Written 2354573 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra Read 2354566 spots for SRR3207844.sra Written 2354566 spots for SRR3207844.sra SRR ids: ['SRR3207844.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5rx4y02e SRR3207844.sra spots: 47091327 blocks: [[1, 2354566], [2354567, 4709132], [4709133, 7063698], [7063699, 9418264], [9418265, 11772830], [11772831, 14127396], [14127397, 16481962], [16481963, 18836528], [18836529, 21191094], [21191095, 23545660], [23545661, 25900226], [25900227, 28254792], [28254793, 30609358], [30609359, 32963924], [32963925, 35318490], [35318491, 37673056], [37673057, 40027622], [40027623, 42382188], [42382189, 44736754], [44736755, 47091327]] SRR3207844 file size 12269182 SRR3207844 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207844 SRR3207844_1.fastq Input file: SRR3207844_1.fastq trimmed: SRR3207844-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:03:46 2025 >> started Tue Feb 11 09:04:10 2025 >> done (24.082s) 47091327 reads processed; of these: 5589 ( 0.01%) short reads filtered out after trimming by size control 13333 ( 0.03%) empty reads filtered out after trimming by size control 47072405 (99.96%) reads available; of these: 2690859 ( 5.72%) trimmed reads available after processing 44381546 (94.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1067 0.00% 19 1435 0.00% 20 1757 0.00% 21 2300 0.00% 22 3269 0.01% 23 4664 0.01% 24 6300 0.01% 25 8287 0.02% 26 7830 0.02% 27 7798 0.02% 28 8087 0.02% 29 8269 0.02% 30 8765 0.02% 31 8841 0.02% 32 9576 0.02% 33 9245 0.02% 34 9994 0.02% 35 9960 0.02% 36 10822 0.02% 37 10909 0.02% 38 11451 0.02% 39 11619 0.02% 40 11879 0.03% 41 12213 0.03% 42 12617 0.03% 43 13349 0.03% 44 13518 0.03% 45 13956 0.03% 46 14519 0.03% 47 15004 0.03% 48 14443 0.03% 49 14173 0.03% 50 13928 0.03% 51 14114 0.03% 52 14452 0.03% 53 15068 0.03% 54 15711 0.03% 55 16487 0.04% 56 17350 0.04% 57 19158 0.04% 58 18861 0.04% 59 18817 0.04% 60 19208 0.04% 61 19752 0.04% 62 20205 0.04% 63 19975 0.04% 64 20085 0.04% 65 21479 0.05% 66 22200 0.05% 67 22666 0.05% 68 23185 0.05% 69 24124 0.05% 70 25482 0.05% 71 26969 0.06% 72 28436 0.06% 73 30071 0.06% 74 30841 0.07% 75 32578 0.07% 76 17699 0.04% 77 20261 0.04% 78 24222 0.05% 79 27443 0.06% 80 29498 0.06% 81 31249 0.07% 82 34058 0.07% 83 36290 0.08% 84 38280 0.08% 85 40241 0.09% 86 43273 0.09% 87 48256 0.10% 88 53670 0.11% 89 57923 0.12% 90 62647 0.13% 91 70884 0.15% 92 79865 0.17% 93 92313 0.20% 94 107147 0.23% 95 132422 0.28% 96 157411 0.33% 97 185538 0.39% 98 216547 0.46% 99 234604 0.50% 100 44381546 94.28% 47072405 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=12.03 fanout-score-rank=11 prefix-density=0.08 prefix-fanout=11.9 sequence=AGATCGGAAGAGCACACGTCTGAACTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=215.00 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=24.4 sequence=AAGAAGAAGAAA Started job on | Feb 11 09:04:38 Started mapping on | Feb 11 09:04:38 Finished on | Feb 11 09:05:22 Mapping speed, Million of reads per hour | 3851.38 Number of input reads | 47072405 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 43957263 Uniquely mapped reads % | 93.38% Average mapped length | 98.73 Number of splices: Total | 13264163 Number of splices: Annotated (sjdb) | 13024738 Number of splices: GT/AG | 13056775 Number of splices: GC/AG | 173571 Number of splices: AT/AC | 13900 Number of splices: Non-canonical | 19917 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 1.89 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1176675 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 1691688 % of reads mapped to too many loci | 3.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1938467 1938467 1938467 N_multimapping 1176675 1176675 1176675 N_noFeature 1590181 22563742 22708359 N_ambiguous 421288 73083 73554 UnstrandedReadsAssigned:41945794 PositiveStrandReadsAssigned:21320438 NegativeStrandReadsAssigned:21175350 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207844 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207844-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,072,405 reads, 44,311,853 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,348 rounds 52401 SRR3207844.ke.tsv 34699 SRR3207844.se.tsv 87100 total ==> SRR3207844.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1799 30.2425 Potri.005G024800.1.v4.1 1035 936 458 15.7852 Potri.004G059700.1.v4.1 961 862 33 1.235 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1112.33 12.6172 Potri.016G087400.1.v4.1 270 171 2089 394.098 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 224.994 4.33588 Potri.012G127500.1.v4.1 977 878 9471 347.987 ==> SRR3207844.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4025 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 836 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR3207844 completed mapping pipeline successfully