Starting /dee2/code/volunteer_pipeline.sh SRR3207845 current disk space = 3055868379136 free memory = 1418597804 SRR3207845 SRAfilesize c1527af6dd8935a0b1a3da0e2c4556a5 SRR3207845.sra SRR3207845.sra file validated SRR3207845 is single end SRR3207845 is conventional basespace SRR3207845 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207845_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31475 34.0 31.0 34.0 31.0 34.0 2 32.811 34.0 33.0 34.0 31.0 34.0 3 33.06175 34.0 33.0 34.0 31.0 34.0 4 36.4745 37.0 37.0 37.0 35.0 37.0 5 36.4265 37.0 37.0 37.0 35.0 37.0 6 36.43725 37.0 37.0 37.0 35.0 37.0 7 36.40725 37.0 37.0 37.0 35.0 37.0 8 36.4635 37.0 37.0 37.0 35.0 37.0 9 38.2265 39.0 39.0 39.0 37.0 39.0 10-11 38.26775000000001 39.0 39.0 39.0 37.0 39.0 12-13 38.199749999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.793125 41.0 40.0 41.0 38.0 41.0 16-17 39.793125 41.0 40.0 41.0 38.0 41.0 18-19 39.701125000000005 41.0 40.0 41.0 37.0 41.0 20-21 39.677875 41.0 40.0 41.0 37.0 41.0 22-23 39.620000000000005 41.0 40.0 41.0 37.0 41.0 24-25 39.604875 41.0 40.0 41.0 37.0 41.0 26-27 39.473124999999996 41.0 39.5 41.0 37.0 41.0 28-29 39.354749999999996 41.0 39.5 41.0 36.5 41.0 30-31 39.2325 41.0 39.0 41.0 36.0 41.0 32-33 39.213499999999996 40.5 39.0 41.0 36.0 41.0 34-35 39.075500000000005 40.0 39.0 41.0 36.0 41.0 36-37 38.926375 40.0 38.5 41.0 35.0 41.0 38-39 38.730875 40.0 38.0 41.0 35.0 41.0 40-41 38.709 40.0 38.0 41.0 35.0 41.0 42-43 38.76425 40.0 38.0 41.0 35.0 41.0 44-45 38.57125 40.0 38.0 41.0 35.0 41.0 46-47 38.57175 40.0 38.0 41.0 34.5 41.0 48-49 38.3005 40.0 38.0 41.0 34.0 41.0 50-51 38.2575 40.0 38.0 41.0 34.0 41.0 52-53 38.543 40.0 38.0 41.0 34.0 41.0 54-55 38.66075 40.0 38.0 41.0 34.5 41.0 56-57 38.546625 40.0 38.0 41.0 34.5 41.0 58-59 38.25925 40.0 38.0 41.0 34.0 41.0 60-61 37.964 40.0 37.0 41.0 34.0 41.0 62-63 37.57325 39.5 36.5 41.0 32.5 41.0 64-65 37.335875 39.0 36.0 41.0 32.5 41.0 66-67 37.073125 39.0 36.0 41.0 33.0 41.0 68-69 36.825125 38.5 35.0 40.0 32.5 41.0 70-71 36.32525 37.0 35.0 39.5 32.0 41.0 72-73 35.864374999999995 37.0 35.0 39.0 31.5 41.0 74-75 35.269499999999994 36.0 35.0 39.0 31.0 40.0 76-77 33.992625000000004 35.0 33.5 37.0 29.5 39.0 78-79 34.298500000000004 35.0 34.0 37.0 30.0 39.0 80-81 34.237750000000005 35.0 34.0 37.0 31.0 38.5 82-83 33.973375000000004 35.0 34.0 36.0 31.0 37.0 84-85 33.746875 35.0 34.0 36.0 31.0 37.0 86-87 33.402125 35.0 34.0 35.5 30.0 36.5 88-89 33.14925 35.0 34.0 35.0 30.0 36.0 90-91 33.065625 35.0 34.0 35.0 30.0 36.0 92-93 32.9405 35.0 34.0 35.0 30.0 36.0 94-95 32.704750000000004 35.0 34.0 35.0 29.5 35.5 96-97 32.358999999999995 35.0 34.0 35.0 29.0 35.0 98-99 32.209875 35.0 34.0 35.0 29.0 35.0 100 32.11875 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 4.0 12 2.0 13 2.0 14 2.0 15 1.0 16 4.0 17 7.0 18 7.0 19 6.0 20 6.0 21 11.0 22 7.0 23 10.0 24 12.0 25 13.0 26 21.0 27 10.0 28 34.0 29 32.0 30 34.0 31 57.0 32 74.0 33 85.0 34 129.0 35 169.0 36 371.0 37 848.0 38 1608.0 39 430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.3899258501662 15.239069291741242 17.847097928918433 41.523906929174125 2 19.825 24.9 35.975 19.3 3 22.650000000000002 26.700000000000003 26.950000000000003 23.7 4 24.575 31.075000000000003 20.4 23.95 5 23.150000000000002 35.9 22.325 18.625 6 18.375 37.875 23.925 19.825 7 16.825000000000003 17.775 44.1 21.3 8 19.7 23.575 29.2 27.525 9 18.925 24.15 32.525 24.4 10-11 22.537499999999998 34.275 23.0 20.1875 12-13 21.1125 27.037499999999998 29.212500000000002 22.6375 14-15 21.712500000000002 27.1625 29.099999999999998 22.025 16-17 21.762500000000003 28.225 27.3875 22.625 18-19 22.375 27.787499999999998 27.224999999999998 22.6125 20-21 21.7 28.762500000000003 27.05 22.4875 22-23 21.575 28.812500000000004 27.2625 22.35 24-25 21.55 28.349999999999998 28.0625 22.037499999999998 26-27 21.8 28.449999999999996 27.325 22.425 28-29 21.712500000000002 28.65 26.737499999999997 22.900000000000002 30-31 21.2625 28.5625 27.6625 22.5125 32-33 21.8125 28.3125 27.3875 22.4875 34-35 21.5375 28.575 27.474999999999998 22.412499999999998 36-37 21.55 29.312500000000004 27.6 21.5375 38-39 21.7 27.750000000000004 27.8875 22.662499999999998 40-41 22.1 28.0875 27.875 21.9375 42-43 21.2875 28.3125 28.65 21.75 44-45 21.637500000000003 27.800000000000004 27.787499999999998 22.775000000000002 46-47 21.762500000000003 28.3875 27.437499999999996 22.412499999999998 48-49 22.77103913967738 28.510691509315993 27.360260097536575 21.35800925347005 50-51 21.497433329159886 28.608989608113184 26.918742957305618 22.97483410542131 52-53 21.898449224612307 28.2016008004002 27.938969484742373 21.96098049024512 54-55 22.225 28.6125 28.012500000000003 21.15 56-57 21.6625 28.249999999999996 28.000000000000004 22.0875 58-59 21.45 28.3375 27.400000000000002 22.8125 60-61 22.275 28.1625 28.249999999999996 21.3125 62-63 22.425 28.525 27.537499999999998 21.512500000000003 64-65 21.825 28.575 27.474999999999998 22.125 66-67 21.4375 28.199999999999996 28.1875 22.175 68-69 21.5375 28.487499999999997 28.375 21.6 70-71 21.3125 27.6125 28.65 22.425 72-73 21.9625 28.3125 28.1375 21.587500000000002 74-75 22.102628285356694 29.574468085106382 27.34668335419274 20.97622027534418 76-77 22.623074032318677 28.410372040586246 27.746461230113994 21.220092696981084 78-79 22.273636818409205 28.489244622311155 27.40120060030015 21.83591795897949 80-81 21.725 29.5875 27.200000000000003 21.4875 82-83 22.8375 27.85 27.35 21.9625 84-85 22.3125 28.237499999999997 27.5625 21.8875 86-87 21.55 28.037499999999998 27.700000000000003 22.7125 88-89 21.775 28.299999999999997 28.299999999999997 21.625 90-91 21.8125 27.450000000000003 29.175 21.5625 92-93 22.675 28.125 27.950000000000003 21.25 94-95 22.162499999999998 29.5375 27.2625 21.0375 96-97 22.75 27.55 27.3 22.400000000000002 98-99 22.425 29.049999999999997 27.9375 20.5875 100 22.775000000000002 28.025 26.775 22.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 3.5 26 5.5 27 8.0 28 9.5 29 11.5 30 18.0 31 26.0 32 37.0 33 51.0 34 65.0 35 76.5 36 87.0 37 113.0 38 150.5 39 180.0 40 192.0 41 216.5 42 259.0 43 264.5 44 251.0 45 255.5 46 249.5 47 252.0 48 231.5 49 179.0 50 154.0 51 140.0 52 122.0 53 94.0 54 71.5 55 53.5 56 33.0 57 27.0 58 25.0 59 20.0 60 14.0 61 9.5 62 8.5 63 5.5 64 2.5 65 2.5 66 3.0 67 3.0 68 4.5 69 2.5 70 0.5 71 1.5 72 1.0 73 0.0 74 1.0 75 1.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0375 50-51 0.1625 52-53 0.05 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.125 76-77 0.21250000000000002 78-79 0.05 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra Read 1446771 spots for SRR3207845.sra Written 1446771 spots for SRR3207845.sra Read 1446762 spots for SRR3207845.sra Written 1446762 spots for SRR3207845.sra SRR ids: ['SRR3207845.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8e18wpsj SRR3207845.sra spots: 28935249 blocks: [[1, 1446762], [1446763, 2893524], [2893525, 4340286], [4340287, 5787048], [5787049, 7233810], [7233811, 8680572], [8680573, 10127334], [10127335, 11574096], [11574097, 13020858], [13020859, 14467620], [14467621, 15914382], [15914383, 17361144], [17361145, 18807906], [18807907, 20254668], [20254669, 21701430], [21701431, 23148192], [23148193, 24594954], [24594955, 26041716], [26041717, 27488478], [27488479, 28935249]] SRR3207845 file size 7534584 SRR3207845 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207845 SRR3207845_1.fastq Input file: SRR3207845_1.fastq trimmed: SRR3207845-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 07:57:28 2025 >> started Tue Feb 11 07:57:52 2025 >> done (24.105s) 28935249 reads processed; of these: 3559 ( 0.01%) short reads filtered out after trimming by size control 7859 ( 0.03%) empty reads filtered out after trimming by size control 28923831 (99.96%) reads available; of these: 1580515 ( 5.46%) trimmed reads available after processing 27343316 (94.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 702 0.00% 19 913 0.00% 20 1044 0.00% 21 1475 0.01% 22 1987 0.01% 23 2714 0.01% 24 3839 0.01% 25 4895 0.02% 26 4598 0.02% 27 4575 0.02% 28 4888 0.02% 29 4886 0.02% 30 5127 0.02% 31 5359 0.02% 32 5805 0.02% 33 5627 0.02% 34 5911 0.02% 35 5996 0.02% 36 6573 0.02% 37 6454 0.02% 38 6613 0.02% 39 6958 0.02% 40 6945 0.02% 41 7131 0.02% 42 7399 0.03% 43 7609 0.03% 44 7816 0.03% 45 8145 0.03% 46 8595 0.03% 47 8860 0.03% 48 8602 0.03% 49 8285 0.03% 50 8387 0.03% 51 8320 0.03% 52 8404 0.03% 53 9130 0.03% 54 9411 0.03% 55 9828 0.03% 56 10307 0.04% 57 11329 0.04% 58 11272 0.04% 59 11093 0.04% 60 11366 0.04% 61 11540 0.04% 62 11913 0.04% 63 11745 0.04% 64 11915 0.04% 65 12469 0.04% 66 14140 0.05% 67 13311 0.05% 68 13883 0.05% 69 14226 0.05% 70 14579 0.05% 71 15633 0.05% 72 16705 0.06% 73 17772 0.06% 74 18180 0.06% 75 18544 0.06% 76 10320 0.04% 77 11886 0.04% 78 14234 0.05% 79 16313 0.06% 80 17369 0.06% 81 18411 0.06% 82 19800 0.07% 83 21237 0.07% 84 22391 0.08% 85 23780 0.08% 86 25511 0.09% 87 28071 0.10% 88 31222 0.11% 89 34040 0.12% 90 36544 0.13% 91 41593 0.14% 92 46472 0.16% 93 54217 0.19% 94 62767 0.22% 95 77379 0.27% 96 92402 0.32% 97 107988 0.37% 98 127090 0.44% 99 137750 0.48% 100 27343316 94.54% 28923831 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=82.32 fanout-score-rank=9 prefix-density=0.74 prefix-fanout=39.4 sequence=AGATCGGAAGAGCACACGTCTGAACT criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=284.08 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=26.9 sequence=TTCTTCTTCTTT Started job on | Feb 11 07:58:10 Started mapping on | Feb 11 07:58:11 Finished on | Feb 11 07:58:47 Mapping speed, Million of reads per hour | 2892.38 Number of input reads | 28923831 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 27714578 Uniquely mapped reads % | 95.82% Average mapped length | 98.55 Number of splices: Total | 7775460 Number of splices: Annotated (sjdb) | 7625313 Number of splices: GT/AG | 7650989 Number of splices: GC/AG | 101302 Number of splices: AT/AC | 8076 Number of splices: Non-canonical | 15093 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 1.93 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 729820 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 325147 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 479433 479433 479433 N_multimapping 729820 729820 729820 N_noFeature 1140290 14229732 14430306 N_ambiguous 288867 47192 47347 UnstrandedReadsAssigned:26285421 PositiveStrandReadsAssigned:13437654 NegativeStrandReadsAssigned:13236925 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207845 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207845-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,923,831 reads, 27,134,561 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR3207845.ke.tsv 34699 SRR3207845.se.tsv 87100 total ==> SRR3207845.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1135 30.6697 Potri.005G024800.1.v4.1 1035 936 236 13.0745 Potri.004G059700.1.v4.1 961 862 38 2.28594 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 639.573 11.6613 Potri.016G087400.1.v4.1 270 171 1495 453.35 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 128 3.965 Potri.012G127500.1.v4.1 977 878 5863 346.269 ==> SRR3207845.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2740 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 517 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207845 completed mapping pipeline successfully