Starting /dee2/code/volunteer_pipeline.sh SRR3207846 current disk space = 3055842291712 free memory = 1403649704 SRR3207846 SRAfilesize 06c9dca5dc239481b8ce752926fae866 SRR3207846.sra SRR3207846.sra file validated SRR3207846 is single end SRR3207846 is conventional basespace SRR3207846 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207846_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.98 34.0 31.0 34.0 30.0 34.0 2 32.367 34.0 31.0 34.0 30.0 34.0 3 31.36125 34.0 31.0 34.0 27.0 34.0 4 35.84025 37.0 35.0 37.0 33.0 37.0 5 35.97275 37.0 35.0 37.0 35.0 37.0 6 36.12225 37.0 35.0 37.0 35.0 37.0 7 36.14075 37.0 36.0 37.0 35.0 37.0 8 36.1305 37.0 36.0 37.0 35.0 37.0 9 37.89275 39.0 38.0 39.0 35.0 39.0 10-11 37.88175 39.0 38.0 39.0 35.0 39.0 12-13 37.83625 39.0 38.0 39.0 35.0 39.0 14-15 39.36875 41.0 39.0 41.0 36.0 41.0 16-17 39.302 41.0 39.0 41.0 36.0 41.0 18-19 39.216750000000005 41.0 39.0 41.0 36.0 41.0 20-21 39.185249999999996 41.0 39.0 41.0 36.0 41.0 22-23 39.099999999999994 40.0 39.0 41.0 36.0 41.0 24-25 39.081875 40.0 39.0 41.0 35.5 41.0 26-27 38.8605 40.0 38.5 41.0 35.0 41.0 28-29 38.826750000000004 40.0 38.0 41.0 35.0 41.0 30-31 38.678625 40.0 38.0 41.0 34.5 41.0 32-33 38.42337499999999 40.0 38.0 41.0 34.0 41.0 34-35 38.367125 40.0 38.0 41.0 34.0 41.0 36-37 38.09025 40.0 38.0 41.0 33.0 41.0 38-39 38.107875 40.0 38.0 41.0 33.5 41.0 40-41 38.102625 40.0 38.0 41.0 33.5 41.0 42-43 38.015625 40.0 38.0 41.0 33.0 41.0 44-45 37.908 40.0 38.0 41.0 33.0 41.0 46-47 37.786375 40.0 38.0 41.0 33.0 41.0 48-49 37.51175 40.0 37.0 41.0 32.0 41.0 50-51 37.63725 40.0 37.0 41.0 33.0 41.0 52-53 37.981624999999994 40.0 38.0 41.0 33.0 41.0 54-55 37.997875 40.0 38.0 41.0 33.0 41.0 56-57 37.702875000000006 40.0 37.0 41.0 33.0 41.0 58-59 37.555875 40.0 37.0 41.0 32.5 41.0 60-61 37.300875000000005 39.5 36.0 41.0 32.0 41.0 62-63 37.119125 39.0 36.0 41.0 32.0 41.0 64-65 36.84225 39.0 35.5 41.0 31.5 41.0 66-67 36.456625 38.5 35.0 40.0 31.0 41.0 68-69 36.046875 37.5 35.0 40.0 31.0 41.0 70-71 35.565250000000006 37.0 35.0 39.0 30.5 41.0 72-73 35.028375 36.5 34.0 39.0 29.5 40.5 74-75 34.465625 36.0 34.0 38.5 29.0 39.5 76-77 32.906000000000006 34.5 32.0 36.5 27.0 39.0 78-79 33.582750000000004 35.0 33.5 37.0 29.0 39.0 80-81 33.3985 35.0 34.0 36.5 29.0 38.0 82-83 33.192375 35.0 34.0 36.0 29.0 37.0 84-85 32.848 35.0 34.0 36.0 29.0 37.0 86-87 32.6005 35.0 33.5 35.0 28.5 36.0 88-89 32.373125 35.0 33.0 35.0 27.5 36.0 90-91 32.121125 35.0 33.0 35.0 26.5 36.0 92-93 31.901625000000003 35.0 33.0 35.0 25.5 35.5 94-95 31.728125 35.0 33.0 35.0 26.0 35.0 96-97 31.512625 35.0 32.5 35.0 25.0 35.0 98-99 31.326875 35.0 33.0 35.0 25.0 35.0 100 31.1975 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 3.0 9 3.0 10 4.0 11 6.0 12 5.0 13 8.0 14 4.0 15 5.0 16 6.0 17 5.0 18 8.0 19 10.0 20 10.0 21 9.0 22 12.0 23 16.0 24 13.0 25 14.0 26 21.0 27 29.0 28 36.0 29 50.0 30 53.0 31 75.0 32 90.0 33 125.0 34 185.0 35 249.0 36 414.0 37 944.0 38 1335.0 39 252.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.949376748918848 15.772068176036633 15.237852963622489 40.04070211142203 2 20.925 23.724999999999998 34.300000000000004 21.05 3 21.825 26.1 26.375 25.7 4 24.775 34.175 19.175 21.875 5 24.075 35.449999999999996 21.875 18.6 6 19.004751187796952 38.45961490372593 24.5311327831958 18.00450112528132 7 17.5 19.05 43.65 19.8 8 20.525 23.825 30.3 25.35 9 20.125 23.525 31.1 25.25 10-11 22.6875 33.387499999999996 23.3625 20.5625 12-13 20.8875 27.224999999999998 28.6375 23.25 14-15 20.8125 28.962500000000002 27.8375 22.3875 16-17 21.875 28.7375 27.1625 22.225 18-19 21.75 29.1375 26.737499999999997 22.375 20-21 22.7375 28.475 27.250000000000004 21.5375 22-23 22.25 29.262500000000003 26.937499999999996 21.55 24-25 21.9 29.7125 26.5625 21.825 26-27 22.05 28.875 27.2625 21.8125 28-29 22.0125 28.3375 27.8125 21.837500000000002 30-31 21.9 28.549999999999997 27.500000000000004 22.05 32-33 21.7375 29.3875 26.525 22.35 34-35 22.400000000000002 28.8875 26.5625 22.15 36-37 22.2625 27.075 28.249999999999996 22.412499999999998 38-39 21.987499999999997 28.237499999999997 28.6875 21.087500000000002 40-41 21.825 28.9125 26.9625 22.3 42-43 21.5375 29.562500000000004 27.400000000000002 21.5 44-45 22.3125 28.462500000000002 27.1625 22.0625 46-47 20.9375 28.287499999999998 27.487499999999997 23.2875 48-49 21.4705514567963 28.360635238214332 27.51031636863824 22.65849693635113 50-51 21.670626484931848 28.67325246967613 27.49781167937977 22.158309366012254 52-53 20.865108138517314 29.128641080135015 27.765970746343292 22.240280035004375 54-55 22.2 28.225 28.212500000000002 21.3625 56-57 21.5375 28.249999999999996 28.0875 22.125 58-59 21.825 28.762500000000003 26.8 22.6125 60-61 21.8 28.1125 28.1375 21.95 62-63 21.7 28.65 27.625 22.025 64-65 20.95 28.462500000000002 27.35 23.2375 66-67 21.337500000000002 28.512500000000003 28.3125 21.837500000000002 68-69 22.537499999999998 28.249999999999996 27.0875 22.125 70-71 22.7625 28.237499999999997 26.55 22.45 72-73 21.325 29.262500000000003 26.9125 22.5 74-75 21.502687835979497 28.141017627203404 27.803475434429302 22.552819102387797 76-77 22.643160790197552 28.057014253563388 27.769442360590148 21.530382595648913 78-79 21.375 28.449999999999996 27.700000000000003 22.475 80-81 21.3125 27.9125 28.3125 22.4625 82-83 23.025000000000002 27.325 27.325 22.325 84-85 20.9125 27.950000000000003 28.287499999999998 22.85 86-87 21.4875 28.849999999999998 27.9125 21.75 88-89 23.150000000000002 27.375 27.450000000000003 22.025 90-91 21.1375 29.099999999999998 27.437499999999996 22.325 92-93 22.825 27.575 27.5625 22.037499999999998 94-95 22.075 28.849999999999998 27.0625 22.0125 96-97 21.5375 28.675 27.962500000000002 21.825 98-99 21.930482620655166 27.831957989497376 28.482120530132534 21.75543885971493 100 23.3 28.325 27.025 21.349999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 2.5 26 2.5 27 5.0 28 10.5 29 9.5 30 14.5 31 26.0 32 33.5 33 48.0 34 57.0 35 68.0 36 96.5 37 119.5 38 140.5 39 160.0 40 181.5 41 232.0 42 267.5 43 256.5 44 282.0 45 277.0 46 249.5 47 248.0 48 218.5 49 190.5 50 159.0 51 141.0 52 113.0 53 82.5 54 68.5 55 49.5 56 37.0 57 29.5 58 24.5 59 21.0 60 15.5 61 12.0 62 8.0 63 4.5 64 5.0 65 4.5 66 3.0 67 3.0 68 2.0 69 0.5 70 1.0 71 2.0 72 1.5 73 1.0 74 0.5 75 1.0 76 1.5 77 1.0 78 1.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0375 50-51 0.0375 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.025 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra Read 2155551 spots for SRR3207846.sra Written 2155551 spots for SRR3207846.sra SRR ids: ['SRR3207846.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wsu9rhyf SRR3207846.sra spots: 43111020 blocks: [[1, 2155551], [2155552, 4311102], [4311103, 6466653], [6466654, 8622204], [8622205, 10777755], [10777756, 12933306], [12933307, 15088857], [15088858, 17244408], [17244409, 19399959], [19399960, 21555510], [21555511, 23711061], [23711062, 25866612], [25866613, 28022163], [28022164, 30177714], [30177715, 32333265], [32333266, 34488816], [34488817, 36644367], [36644368, 38799918], [38799919, 40955469], [40955470, 43111020]] SRR3207846 file size 11230812 SRR3207846 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207846 SRR3207846_1.fastq Input file: SRR3207846_1.fastq trimmed: SRR3207846-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 08:10:51 2025 >> started Tue Feb 11 08:11:13 2025 >> done (21.119s) 43111020 reads processed; of these: 4355 ( 0.01%) short reads filtered out after trimming by size control 19358 ( 0.04%) empty reads filtered out after trimming by size control 43087307 (99.94%) reads available; of these: 3340381 ( 7.75%) trimmed reads available after processing 39746926 (92.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 996 0.00% 19 1334 0.00% 20 1907 0.00% 21 2206 0.01% 22 3121 0.01% 23 4821 0.01% 24 6434 0.01% 25 8233 0.02% 26 9162 0.02% 27 8836 0.02% 28 8661 0.02% 29 8868 0.02% 30 9251 0.02% 31 9397 0.02% 32 9954 0.02% 33 10134 0.02% 34 10672 0.02% 35 11000 0.03% 36 11618 0.03% 37 11909 0.03% 38 12313 0.03% 39 13178 0.03% 40 13115 0.03% 41 13794 0.03% 42 14281 0.03% 43 14821 0.03% 44 15308 0.04% 45 16310 0.04% 46 16611 0.04% 47 17167 0.04% 48 17632 0.04% 49 16544 0.04% 50 15940 0.04% 51 16278 0.04% 52 17432 0.04% 53 18450 0.04% 54 19251 0.04% 55 19960 0.05% 56 20572 0.05% 57 21204 0.05% 58 22154 0.05% 59 22161 0.05% 60 22946 0.05% 61 23741 0.06% 62 23951 0.06% 63 24051 0.06% 64 24390 0.06% 65 26155 0.06% 66 27110 0.06% 67 28366 0.07% 68 29111 0.07% 69 30343 0.07% 70 31907 0.07% 71 34179 0.08% 72 34194 0.08% 73 36464 0.08% 74 37571 0.09% 75 40076 0.09% 76 22316 0.05% 77 25749 0.06% 78 30859 0.07% 79 34219 0.08% 80 37074 0.09% 81 40497 0.09% 82 42440 0.10% 83 45966 0.11% 84 47684 0.11% 85 51119 0.12% 86 54500 0.13% 87 59487 0.14% 88 64202 0.15% 89 70643 0.16% 90 80307 0.19% 91 90446 0.21% 92 103864 0.24% 93 119021 0.28% 94 139614 0.32% 95 168440 0.39% 96 201479 0.47% 97 235340 0.55% 98 278178 0.65% 99 299392 0.69% 100 39746926 92.25% 43087307 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=31.34 fanout-score-rank=13 prefix-density=0.16 prefix-fanout=21.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=230.13 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=20.2 sequence=CTTCTTCTTCTT Started job on | Feb 11 08:11:32 Started mapping on | Feb 11 08:11:32 Finished on | Feb 11 08:12:15 Mapping speed, Million of reads per hour | 3607.31 Number of input reads | 43087307 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 40629267 Uniquely mapped reads % | 94.30% Average mapped length | 98.21 Number of splices: Total | 11797054 Number of splices: Annotated (sjdb) | 11564174 Number of splices: GT/AG | 11605907 Number of splices: GC/AG | 157269 Number of splices: AT/AC | 12454 Number of splices: Non-canonical | 21424 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1128187 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 506648 % of reads mapped to too many loci | 1.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1329853 1329853 1329853 N_multimapping 1128187 1128187 1128187 N_noFeature 1676127 20858692 21184603 N_ambiguous 407657 73399 72984 UnstrandedReadsAssigned:38545483 PositiveStrandReadsAssigned:19697176 NegativeStrandReadsAssigned:19371680 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207846 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207846-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,087,307 reads, 39,894,929 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,331 rounds 52401 SRR3207846.ke.tsv 34699 SRR3207846.se.tsv 87100 total ==> SRR3207846.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1971.5 34.6327 Potri.005G024800.1.v4.1 1035 936 897 32.3059 Potri.004G059700.1.v4.1 961 862 18 0.703931 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1119.43 13.2688 Potri.016G087400.1.v4.1 270 171 1706 336.316 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 210.623 4.24146 Potri.012G127500.1.v4.1 977 878 4695 180.263 ==> SRR3207846.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1895 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 737 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 40 SRR3207846 completed mapping pipeline successfully