Starting /dee2/code/volunteer_pipeline.sh SRR3207847 current disk space = 3055554068480 free memory = 1580283272 SRR3207847 SRAfilesize 2f982dec620bb6ed4fbffa0b53c59a03 SRR3207847.sra SRR3207847.sra file validated SRR3207847 is single end SRR3207847 is conventional basespace SRR3207847 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207847_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.00725 34.0 31.0 34.0 31.0 34.0 2 32.4465 34.0 31.0 34.0 31.0 34.0 3 31.28675 34.0 31.0 34.0 27.0 34.0 4 35.86975 37.0 35.0 37.0 33.0 37.0 5 35.93025 37.0 35.0 37.0 35.0 37.0 6 36.15775 37.0 36.0 37.0 35.0 37.0 7 36.203 37.0 37.0 37.0 35.0 37.0 8 36.151 37.0 37.0 37.0 35.0 37.0 9 37.98975 39.0 38.0 39.0 35.0 39.0 10-11 37.953125 39.0 38.0 39.0 35.0 39.0 12-13 37.884874999999994 39.0 38.0 39.0 35.0 39.0 14-15 39.396625 41.0 39.0 41.0 36.0 41.0 16-17 39.3665 41.0 39.0 41.0 36.0 41.0 18-19 39.325375 41.0 39.0 41.0 36.0 41.0 20-21 39.315375 41.0 39.0 41.0 36.0 41.0 22-23 39.176874999999995 40.5 39.0 41.0 35.5 41.0 24-25 39.218375 40.0 39.0 41.0 36.0 41.0 26-27 39.04125 40.0 39.0 41.0 35.5 41.0 28-29 38.974999999999994 40.0 38.5 41.0 35.0 41.0 30-31 38.881874999999994 40.0 38.0 41.0 35.0 41.0 32-33 38.66275 40.0 38.0 41.0 35.0 41.0 34-35 38.567625 40.0 38.0 41.0 34.5 41.0 36-37 38.321125 40.0 38.0 41.0 34.0 41.0 38-39 38.294124999999994 40.0 38.0 41.0 34.0 41.0 40-41 38.230125 40.0 38.0 41.0 34.0 41.0 42-43 38.270125 40.0 38.0 41.0 34.0 41.0 44-45 38.126374999999996 40.0 38.0 41.0 33.0 41.0 46-47 37.897999999999996 40.0 38.0 41.0 33.0 41.0 48-49 37.5975 40.0 37.0 41.0 32.0 41.0 50-51 37.623999999999995 40.0 37.0 41.0 33.0 41.0 52-53 38.003375000000005 40.0 38.0 41.0 33.0 41.0 54-55 38.103375 40.0 38.0 41.0 33.5 41.0 56-57 37.88825 40.0 37.0 41.0 33.0 41.0 58-59 37.716125 40.0 37.0 41.0 33.0 41.0 60-61 37.513 39.5 36.5 41.0 32.5 41.0 62-63 37.2335 39.0 36.0 41.0 32.0 41.0 64-65 36.97625 39.0 35.5 41.0 32.0 41.0 66-67 36.670125 39.0 35.0 40.5 31.5 41.0 68-69 36.256375 37.5 35.0 40.0 31.0 41.0 70-71 35.837999999999994 37.0 35.0 39.0 31.0 41.0 72-73 35.235125 36.5 35.0 39.0 30.0 41.0 74-75 34.753249999999994 36.0 34.0 39.0 29.5 40.0 76-77 33.19625 34.5 32.0 36.5 27.5 39.0 78-79 33.902375 35.0 34.0 37.0 29.0 39.0 80-81 33.73975 35.0 34.0 36.5 29.0 38.5 82-83 33.411249999999995 35.0 34.0 36.0 29.0 37.0 84-85 33.10525 35.0 34.0 36.0 29.0 37.0 86-87 32.86725 35.0 34.0 35.5 29.0 36.5 88-89 32.682 35.0 34.0 35.0 29.0 36.0 90-91 32.422 35.0 33.0 35.0 28.0 36.0 92-93 32.200874999999996 35.0 33.0 35.0 27.0 36.0 94-95 31.872625 35.0 33.0 35.0 25.5 35.0 96-97 31.773625 35.0 33.0 35.0 26.0 35.0 98-99 31.6565 35.0 33.0 35.0 26.5 35.0 100 31.54375 35.0 33.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 3.0 11 4.0 12 4.0 13 5.0 14 0.0 15 9.0 16 9.0 17 8.0 18 7.0 19 10.0 20 8.0 21 8.0 22 13.0 23 13.0 24 11.0 25 13.0 26 20.0 27 30.0 28 30.0 29 36.0 30 55.0 31 82.0 32 73.0 33 116.0 34 159.0 35 270.0 36 429.0 37 901.0 38 1387.0 39 284.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.122521606507373 15.607524148449414 14.438230808337572 42.831723436705644 2 20.075000000000003 23.95 36.375 19.6 3 22.0 25.724999999999998 26.775 25.5 4 25.275 31.45 20.7 22.575 5 24.224999999999998 35.9 22.05 17.825 6 18.525 36.9 23.3 21.275 7 17.025000000000002 19.725 41.949999999999996 21.3 8 19.425 23.525 30.575000000000003 26.474999999999998 9 20.45 23.925 31.125000000000004 24.5 10-11 21.925 33.9375 23.2375 20.9 12-13 21.1125 26.950000000000003 28.712500000000002 23.225 14-15 20.7 28.299999999999997 29.062500000000004 21.9375 16-17 20.7375 28.9375 27.6375 22.6875 18-19 22.4375 29.4125 26.674999999999997 21.475 20-21 21.4375 28.549999999999997 27.85 22.162499999999998 22-23 21.825 28.175 28.3125 21.6875 24-25 21.5 28.575 27.650000000000002 22.275 26-27 21.4 28.6875 28.1 21.8125 28-29 21.712500000000002 28.712500000000002 27.925 21.65 30-31 21.512500000000003 28.65 27.675 22.162499999999998 32-33 20.8875 29.3875 27.700000000000003 22.025 34-35 21.475 28.287499999999998 28.0875 22.15 36-37 21.6875 28.5875 27.5625 22.162499999999998 38-39 21.987499999999997 29.175 27.05 21.7875 40-41 22.0625 27.675 27.762500000000003 22.5 42-43 21.462500000000002 28.425 28.3375 21.775 44-45 21.975 28.225 28.025 21.775 46-47 22.2 27.825 27.950000000000003 22.025 48-49 21.4875 27.825 28.849999999999998 21.837500000000002 50-51 22.033262473427534 27.997999249718646 27.360260097536575 22.608478179317242 52-53 22.2 27.962500000000002 27.3 22.537499999999998 54-55 21.575 28.375 27.500000000000004 22.55 56-57 21.2 28.8875 28.199999999999996 21.712500000000002 58-59 22.625 28.787499999999998 27.8375 20.75 60-61 21.8 28.325 27.775 22.1 62-63 21.2625 28.275 28.125 22.3375 64-65 21.6 28.65 28.1 21.65 66-67 21.987499999999997 28.812500000000004 27.675 21.525 68-69 22.662499999999998 28.000000000000004 27.737499999999997 21.6 70-71 21.45 28.237499999999997 28.325 21.987499999999997 72-73 21.85 28.9375 27.737499999999997 21.475 74-75 22.45 28.762500000000003 27.1 21.6875 76-77 22.3125 28.0875 27.700000000000003 21.9 78-79 21.7875 28.3375 28.299999999999997 21.575 80-81 21.3875 28.262500000000003 28.9 21.45 82-83 21.825 27.625 29.225 21.325 84-85 22.2625 27.6875 28.15 21.9 86-87 21.675 28.462500000000002 28.125 21.7375 88-89 22.9625 27.825 27.3125 21.9 90-91 22.6375 29.062500000000004 27.075 21.224999999999998 92-93 22.15 28.012500000000003 27.55 22.287499999999998 94-95 21.9375 28.375 27.9375 21.75 96-97 20.5375 28.175 28.5625 22.725 98-99 22.7375 27.725 28.1625 21.375 100 21.675 27.750000000000004 28.375 22.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 1.5 25 2.0 26 3.5 27 5.0 28 7.0 29 13.5 30 23.0 31 26.0 32 30.0 33 43.0 34 57.5 35 74.5 36 100.5 37 121.0 38 153.5 39 202.5 40 226.5 41 228.5 42 222.0 43 247.5 44 266.5 45 265.5 46 273.0 47 247.5 48 210.5 49 179.0 50 160.0 51 135.0 52 101.5 53 77.0 54 61.5 55 47.5 56 38.5 57 29.0 58 18.5 59 18.0 60 12.5 61 8.5 62 8.5 63 8.0 64 8.0 65 5.5 66 3.5 67 3.5 68 3.0 69 3.5 70 3.0 71 2.5 72 2.0 73 2.0 74 2.5 75 1.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0375 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498983 spots for SRR3207847.sra Written 2498983 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra Read 2498970 spots for SRR3207847.sra Written 2498970 spots for SRR3207847.sra SRR ids: ['SRR3207847.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f_jaaaqm SRR3207847.sra spots: 49979413 blocks: [[1, 2498970], [2498971, 4997940], [4997941, 7496910], [7496911, 9995880], [9995881, 12494850], [12494851, 14993820], [14993821, 17492790], [17492791, 19991760], [19991761, 22490730], [22490731, 24989700], [24989701, 27488670], [27488671, 29987640], [29987641, 32486610], [32486611, 34985580], [34985581, 37484550], [37484551, 39983520], [39983521, 42482490], [42482491, 44981460], [44981461, 47480430], [47480431, 49979413]] SRR3207847 file size 13022042 SRR3207847 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207847 SRR3207847_1.fastq Input file: SRR3207847_1.fastq trimmed: SRR3207847-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:05:03 2025 >> started Tue Feb 11 09:05:30 2025 >> done (27.384s) 49979413 reads processed; of these: 5937 ( 0.01%) short reads filtered out after trimming by size control 18910 ( 0.04%) empty reads filtered out after trimming by size control 49954566 (99.95%) reads available; of these: 3957944 ( 7.92%) trimmed reads available after processing 45996622 (92.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1170 0.00% 19 1618 0.00% 20 2122 0.00% 21 2640 0.01% 22 3865 0.01% 23 5624 0.01% 24 7680 0.02% 25 9926 0.02% 26 10492 0.02% 27 10194 0.02% 28 10026 0.02% 29 10539 0.02% 30 11062 0.02% 31 11322 0.02% 32 11669 0.02% 33 12001 0.02% 34 12612 0.03% 35 12851 0.03% 36 13788 0.03% 37 13968 0.03% 38 14569 0.03% 39 15441 0.03% 40 15616 0.03% 41 16455 0.03% 42 16605 0.03% 43 17895 0.04% 44 17961 0.04% 45 18984 0.04% 46 19823 0.04% 47 20372 0.04% 48 20074 0.04% 49 19536 0.04% 50 19100 0.04% 51 19569 0.04% 52 20410 0.04% 53 21888 0.04% 54 22455 0.04% 55 23482 0.05% 56 24474 0.05% 57 25204 0.05% 58 25964 0.05% 59 26464 0.05% 60 26933 0.05% 61 27899 0.06% 62 28624 0.06% 63 28809 0.06% 64 29361 0.06% 65 30626 0.06% 66 32193 0.06% 67 33367 0.07% 68 34319 0.07% 69 35828 0.07% 70 38102 0.08% 71 40196 0.08% 72 40706 0.08% 73 43371 0.09% 74 45292 0.09% 75 47287 0.09% 76 26142 0.05% 77 30703 0.06% 78 36617 0.07% 79 40724 0.08% 80 44289 0.09% 81 47657 0.10% 82 51090 0.10% 83 54242 0.11% 84 56462 0.11% 85 61316 0.12% 86 64504 0.13% 87 70996 0.14% 88 76510 0.15% 89 83674 0.17% 90 95319 0.19% 91 106280 0.21% 92 123468 0.25% 93 141364 0.28% 94 164782 0.33% 95 200459 0.40% 96 239146 0.48% 97 279188 0.56% 98 329096 0.66% 99 353493 0.71% 100 45996622 92.08% 49954566 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=7.73 fanout-score-rank=22 prefix-density=0.05 prefix-fanout=7.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=316.06 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=27.8 sequence=TTCTTCTTCTTT Started job on | Feb 11 09:05:46 Started mapping on | Feb 11 09:05:46 Finished on | Feb 11 09:06:35 Mapping speed, Million of reads per hour | 3670.13 Number of input reads | 49954566 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 46859583 Uniquely mapped reads % | 93.80% Average mapped length | 98.21 Number of splices: Total | 13739360 Number of splices: Annotated (sjdb) | 13455684 Number of splices: GT/AG | 13511812 Number of splices: GC/AG | 187520 Number of splices: AT/AC | 14315 Number of splices: Non-canonical | 25713 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1266999 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 947585 % of reads mapped to too many loci | 1.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1827984 1827984 1827984 N_multimapping 1266999 1266999 1266999 N_noFeature 2410904 24346322 24670449 N_ambiguous 430043 89187 87897 UnstrandedReadsAssigned:44018636 PositiveStrandReadsAssigned:22424074 NegativeStrandReadsAssigned:22101237 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207847 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207847-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 49,954,566 reads, 45,825,828 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR3207847.ke.tsv 34699 SRR3207847.se.tsv 87100 total ==> SRR3207847.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2299 37.7075 Potri.005G024800.1.v4.1 1035 936 917 30.8359 Potri.004G059700.1.v4.1 961 862 15 0.547706 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1347.41 14.912 Potri.016G087400.1.v4.1 270 171 1586 291.925 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 310.215 5.83273 Potri.012G127500.1.v4.1 977 878 6156 220.682 ==> SRR3207847.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2550 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 615 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 46 SRR3207847 completed mapping pipeline successfully