Starting /dee2/code/volunteer_pipeline.sh SRR3207848 current disk space = 3055472799744 free memory = 1578920360 SRR3207848 SRAfilesize 1aa6be18bfd75d1b74338dd28fd4546e SRR3207848.sra SRR3207848.sra file validated SRR3207848 is single end SRR3207848 is conventional basespace SRR3207848 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207848_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.945 34.0 31.0 34.0 30.0 34.0 2 32.43025 34.0 31.0 34.0 31.0 34.0 3 31.50425 34.0 31.0 34.0 27.0 34.0 4 35.94775 37.0 35.0 37.0 35.0 37.0 5 36.04425 37.0 35.0 37.0 35.0 37.0 6 36.1925 37.0 37.0 37.0 35.0 37.0 7 36.2 37.0 37.0 37.0 35.0 37.0 8 36.27175 37.0 37.0 37.0 35.0 37.0 9 38.02375 39.0 39.0 39.0 35.0 39.0 10-11 37.985 39.0 38.5 39.0 35.0 39.0 12-13 37.96875 39.0 38.0 39.0 35.0 39.0 14-15 39.486125 41.0 39.0 41.0 36.0 41.0 16-17 39.436375 41.0 39.0 41.0 36.0 41.0 18-19 39.387375 41.0 39.0 41.0 36.0 41.0 20-21 39.388375 41.0 39.0 41.0 36.0 41.0 22-23 39.29775 41.0 39.0 41.0 36.0 41.0 24-25 39.281499999999994 41.0 39.0 41.0 36.0 41.0 26-27 39.1185 40.0 39.0 41.0 36.0 41.0 28-29 39.060125 40.0 39.0 41.0 35.5 41.0 30-31 38.915875 40.0 38.5 41.0 35.5 41.0 32-33 38.747625 40.0 38.0 41.0 35.0 41.0 34-35 38.678125 40.0 38.0 41.0 35.0 41.0 36-37 38.434 40.0 38.0 41.0 34.0 41.0 38-39 38.267250000000004 40.0 38.0 41.0 34.0 41.0 40-41 38.319 40.0 38.0 41.0 33.5 41.0 42-43 38.300625 40.0 38.0 41.0 34.0 41.0 44-45 38.24525 40.0 38.0 41.0 33.5 41.0 46-47 38.05825 40.0 38.0 41.0 33.0 41.0 48-49 37.800375 40.0 37.5 41.0 33.0 41.0 50-51 37.810874999999996 40.0 37.5 41.0 33.0 41.0 52-53 38.096000000000004 40.0 38.0 41.0 33.5 41.0 54-55 38.193625 40.0 38.0 41.0 33.5 41.0 56-57 38.02975 40.0 38.0 41.0 33.0 41.0 58-59 37.820875 40.0 37.0 41.0 33.0 41.0 60-61 37.6095 40.0 37.0 41.0 33.0 41.0 62-63 37.211875 39.0 36.0 41.0 32.0 41.0 64-65 36.981625 39.0 36.0 41.0 32.0 41.0 66-67 36.741 38.5 35.0 40.5 31.5 41.0 68-69 36.25175 37.5 35.0 40.0 31.0 41.0 70-71 35.891999999999996 37.0 35.0 39.5 31.0 41.0 72-73 35.306375 36.5 35.0 39.0 30.0 41.0 74-75 34.778999999999996 36.0 34.0 38.5 29.5 40.0 76-77 33.2175 34.5 32.5 36.5 27.5 39.0 78-79 33.902875 35.0 34.0 37.0 29.0 39.0 80-81 33.798500000000004 35.0 34.0 36.5 29.5 38.5 82-83 33.501125 35.0 34.0 36.0 29.0 37.0 84-85 33.1555 35.0 34.0 36.0 29.0 37.0 86-87 32.8545 35.0 34.0 35.0 29.0 36.5 88-89 32.75675 35.0 34.0 35.0 29.0 36.0 90-91 32.55825 35.0 33.0 35.0 28.5 36.0 92-93 32.362875 35.0 33.0 35.0 27.5 36.0 94-95 32.137375 35.0 33.0 35.0 27.0 35.0 96-97 31.854625 35.0 33.0 35.0 26.0 35.0 98-99 31.65625 35.0 33.0 35.0 26.5 35.0 100 31.5005 35.0 33.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 2.0 11 4.0 12 1.0 13 5.0 14 4.0 15 5.0 16 8.0 17 9.0 18 5.0 19 2.0 20 10.0 21 8.0 22 8.0 23 9.0 24 17.0 25 20.0 26 18.0 27 27.0 28 37.0 29 47.0 30 50.0 31 64.0 32 105.0 33 99.0 34 162.0 35 247.0 36 415.0 37 845.0 38 1476.0 39 289.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.034729315628194 15.270684371807967 14.24923391215526 41.44535240040858 2 20.549999999999997 23.075000000000003 35.35 21.025 3 22.5 26.150000000000002 26.0 25.35 4 24.0 32.425 20.625 22.95 5 23.625 36.075 22.325 17.974999999999998 6 18.72968242060515 38.13453363340835 25.35633908477119 17.779444861215303 7 16.875 20.599999999999998 42.6 19.925 8 18.575 23.225 31.225 26.974999999999998 9 21.275 23.974999999999998 30.825000000000003 23.925 10-11 22.787499999999998 34.362500000000004 22.3375 20.5125 12-13 20.6125 26.987499999999997 29.4 23.0 14-15 20.674999999999997 27.925 29.4875 21.912499999999998 16-17 22.0 28.249999999999996 27.9125 21.837500000000002 18-19 22.4375 27.525 27.474999999999998 22.5625 20-21 22.037499999999998 29.4875 26.687499999999996 21.7875 22-23 21.8 28.65 27.3625 22.1875 24-25 21.825 28.275 28.287499999999998 21.6125 26-27 20.974999999999998 29.049999999999997 27.287499999999998 22.6875 28-29 22.162499999999998 28.787499999999998 27.037499999999998 22.0125 30-31 21.5 28.975 27.537499999999998 21.987499999999997 32-33 21.65 28.6375 27.3875 22.325 34-35 21.912499999999998 28.225 27.8125 22.05 36-37 23.025000000000002 28.7375 27.1 21.1375 38-39 22.325 28.5625 27.3875 21.725 40-41 22.25 28.65 26.85 22.25 42-43 21.7 28.575 27.675 22.05 44-45 21.575 29.625 27.0625 21.7375 46-47 21.725 28.549999999999997 27.725 22.0 48-49 22.18054513628407 28.769692423105774 27.056764191047762 21.99299824956239 50-51 22.511255627813906 28.601800900450225 27.138569284642323 21.748374187093546 52-53 21.75 28.762500000000003 27.737499999999997 21.75 54-55 21.987499999999997 27.325 28.075 22.6125 56-57 22.325 28.375 27.575 21.725 58-59 21.6 28.449999999999996 27.962500000000002 21.987499999999997 60-61 22.325 28.762500000000003 26.200000000000003 22.7125 62-63 21.637500000000003 28.8875 27.175 22.3 64-65 22.375 28.3125 28.349999999999998 20.962500000000002 66-67 21.75 28.175 28.212500000000002 21.8625 68-69 21.349999999999998 28.999999999999996 27.750000000000004 21.9 70-71 21.224999999999998 27.8375 28.425 22.5125 72-73 22.25 27.800000000000004 27.825 22.125 74-75 22.725 28.1 27.1625 22.0125 76-77 22.00275034379297 28.9536192024003 27.628453556694588 21.41517689711214 78-79 22.325 28.4125 27.900000000000002 21.3625 80-81 22.525000000000002 28.075 27.6375 21.762500000000003 82-83 22.025 28.425 27.750000000000004 21.8 84-85 22.162499999999998 28.3125 28.4125 21.1125 86-87 21.925 27.800000000000004 29.225 21.05 88-89 21.575 27.712500000000002 28.6875 22.025 90-91 22.075 28.237499999999997 27.650000000000002 22.037499999999998 92-93 21.8625 28.075 28.3875 21.675 94-95 22.6 28.299999999999997 26.974999999999998 22.125 96-97 22.2625 28.3625 27.787499999999998 21.587500000000002 98-99 22.6875 27.55 27.800000000000004 21.9625 100 20.974999999999998 29.349999999999998 28.849999999999998 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.5 23 1.5 24 0.0 25 0.0 26 0.5 27 5.5 28 9.0 29 8.5 30 18.0 31 26.0 32 33.0 33 37.0 34 48.0 35 78.5 36 104.5 37 122.0 38 142.0 39 175.5 40 197.0 41 216.0 42 244.0 43 268.5 44 281.5 45 275.0 46 266.0 47 263.0 48 234.0 49 186.0 50 161.0 51 138.0 52 108.5 53 71.0 54 48.5 55 50.5 56 41.5 57 27.5 58 20.0 59 16.5 60 15.0 61 10.5 62 10.0 63 11.0 64 6.5 65 4.0 66 4.5 67 3.5 68 1.0 69 1.0 70 1.0 71 0.0 72 1.5 73 2.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.025 50-51 0.05 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.025 0.0 0.0 0.025 0.0 30-31 0.025 0.0 0.0 0.025 0.0 32-33 0.025 0.0 0.0 0.025 0.0 34-35 0.025 0.0 0.0 0.025 0.0 36-37 0.025 0.0 0.0 0.025 0.0 38-39 0.025 0.0 0.0 0.025 0.0 40-41 0.025 0.0 0.0 0.025 0.0 42-43 0.025 0.0 0.0 0.025 0.0 44-45 0.025 0.0 0.0 0.025 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.0625 0.0 0.0 0.025 0.0 88 0.1 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803202 spots for SRR3207848.sra Written 2803202 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra Read 2803199 spots for SRR3207848.sra Written 2803199 spots for SRR3207848.sra SRR ids: ['SRR3207848.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__8lu3hru SRR3207848.sra spots: 56063983 blocks: [[1, 2803199], [2803200, 5606398], [5606399, 8409597], [8409598, 11212796], [11212797, 14015995], [14015996, 16819194], [16819195, 19622393], [19622394, 22425592], [22425593, 25228791], [25228792, 28031990], [28031991, 30835189], [30835190, 33638388], [33638389, 36441587], [36441588, 39244786], [39244787, 42047985], [42047986, 44851184], [44851185, 47654383], [47654384, 50457582], [50457583, 53260781], [53260782, 56063983]] SRR3207848 file size 14608509 SRR3207848 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207848 SRR3207848_1.fastq Input file: SRR3207848_1.fastq trimmed: SRR3207848-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:13:53 2025 >> started Tue Feb 11 09:14:31 2025 >> done (38.764s) 56063983 reads processed; of these: 6142 ( 0.01%) short reads filtered out after trimming by size control 16218 ( 0.03%) empty reads filtered out after trimming by size control 56041623 (99.96%) reads available; of these: 4215571 ( 7.52%) trimmed reads available after processing 51826052 (92.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1168 0.00% 19 1655 0.00% 20 2104 0.00% 21 2707 0.00% 22 3704 0.01% 23 5692 0.01% 24 7608 0.01% 25 9684 0.02% 26 10115 0.02% 27 9770 0.02% 28 10310 0.02% 29 10345 0.02% 30 11013 0.02% 31 11207 0.02% 32 11723 0.02% 33 11923 0.02% 34 12449 0.02% 35 13170 0.02% 36 13853 0.02% 37 15226 0.03% 38 14923 0.03% 39 15644 0.03% 40 15744 0.03% 41 16691 0.03% 42 16844 0.03% 43 17640 0.03% 44 18232 0.03% 45 19600 0.03% 46 20247 0.04% 47 20707 0.04% 48 20566 0.04% 49 20336 0.04% 50 19866 0.04% 51 20280 0.04% 52 21233 0.04% 53 22184 0.04% 54 23442 0.04% 55 24931 0.04% 56 25714 0.05% 57 26456 0.05% 58 26850 0.05% 59 27645 0.05% 60 28270 0.05% 61 29424 0.05% 62 29843 0.05% 63 30252 0.05% 64 30997 0.06% 65 32974 0.06% 66 34473 0.06% 67 35192 0.06% 68 36524 0.07% 69 37968 0.07% 70 40302 0.07% 71 42732 0.08% 72 43395 0.08% 73 46596 0.08% 74 48275 0.09% 75 50167 0.09% 76 28193 0.05% 77 32537 0.06% 78 39045 0.07% 79 43306 0.08% 80 47315 0.08% 81 50984 0.09% 82 53445 0.10% 83 58045 0.10% 84 60479 0.11% 85 65608 0.12% 86 69505 0.12% 87 76069 0.14% 88 81606 0.15% 89 89816 0.16% 90 102858 0.18% 91 114795 0.20% 92 132503 0.24% 93 151524 0.27% 94 177881 0.32% 95 215456 0.38% 96 257966 0.46% 97 301432 0.54% 98 354293 0.63% 99 382325 0.68% 100 51826052 92.48% 56041623 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=19.68 fanout-score-rank=18 prefix-density=0.09 prefix-fanout=15.3 sequence=AGATCGGAAGAGCACACGTCTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=353.64 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=30.0 sequence=TTCTTCTTCTTC Started job on | Feb 11 09:14:47 Started mapping on | Feb 11 09:14:47 Finished on | Feb 11 09:15:45 Mapping speed, Million of reads per hour | 3478.45 Number of input reads | 56041623 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 53588816 Uniquely mapped reads % | 95.62% Average mapped length | 98.19 Number of splices: Total | 15871956 Number of splices: Annotated (sjdb) | 15544750 Number of splices: GT/AG | 15613269 Number of splices: GC/AG | 212144 Number of splices: AT/AC | 16290 Number of splices: Non-canonical | 30253 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1427907 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 272785 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1024900 1024900 1024900 N_multimapping 1427907 1427907 1427907 N_noFeature 2559705 27760594 28074017 N_ambiguous 515641 101677 101106 UnstrandedReadsAssigned:50513470 PositiveStrandReadsAssigned:25726545 NegativeStrandReadsAssigned:25413693 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207848 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207848-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,041,623 reads, 51,923,564 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,263 rounds 52401 SRR3207848.ke.tsv 34699 SRR3207848.se.tsv 87100 total ==> SRR3207848.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2820 40.504 Potri.005G024800.1.v4.1 1035 936 1142 33.629 Potri.004G059700.1.v4.1 961 862 14 0.447656 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1429.64 13.8554 Potri.016G087400.1.v4.1 270 171 2218 357.511 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 457.051 7.52545 Potri.012G127500.1.v4.1 977 878 5893 184.997 ==> SRR3207848.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3945 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 861 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 45 SRR3207848 completed mapping pipeline successfully