Starting /dee2/code/volunteer_pipeline.sh SRR3207849 current disk space = 3055631925248 free memory = 1579335636 SRR3207849 SRAfilesize ec2a89d2e5c77bd317136304074ab53b SRR3207849.sra SRR3207849.sra file validated SRR3207849 is single end SRR3207849 is conventional basespace SRR3207849 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207849_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05075 34.0 33.0 34.0 31.0 34.0 2 33.3 34.0 34.0 34.0 31.0 34.0 3 33.47525 34.0 34.0 34.0 31.0 34.0 4 36.69775 37.0 37.0 37.0 35.0 37.0 5 36.58875 37.0 37.0 37.0 35.0 37.0 6 36.66625 37.0 37.0 37.0 35.0 37.0 7 36.47425 37.0 37.0 37.0 35.0 37.0 8 36.60825 37.0 37.0 37.0 35.0 37.0 9 38.53825 39.0 39.0 39.0 38.0 39.0 10-11 38.582125000000005 39.0 39.0 39.0 38.0 39.0 12-13 38.533625 39.0 39.0 39.0 38.0 39.0 14-15 40.300124999999994 41.0 40.0 41.0 39.0 41.0 16-17 40.277375 41.0 40.0 41.0 39.0 41.0 18-19 40.265125 41.0 40.0 41.0 39.0 41.0 20-21 40.2595 41.0 40.0 41.0 39.0 41.0 22-23 40.15625 41.0 40.0 41.0 39.0 41.0 24-25 39.994625 41.0 40.0 41.0 38.0 41.0 26-27 39.809125 41.0 40.0 41.0 37.5 41.0 28-29 39.933875 41.0 40.0 41.0 38.0 41.0 30-31 39.708625 41.0 40.0 41.0 38.0 41.0 32-33 39.87425 41.0 40.0 41.0 38.0 41.0 34-35 39.802375 41.0 40.0 41.0 38.0 41.0 36-37 39.758875 41.0 40.0 41.0 38.0 41.0 38-39 39.645875000000004 41.0 40.0 41.0 38.0 41.0 40-41 39.599875 41.0 40.0 41.0 37.0 41.0 42-43 39.445499999999996 41.0 40.0 41.0 37.0 41.0 44-45 39.470875 41.0 40.0 41.0 37.0 41.0 46-47 39.330749999999995 41.0 40.0 41.0 36.5 41.0 48-49 39.325125 41.0 40.0 41.0 36.0 41.0 50-51 39.26275 41.0 39.0 41.0 36.0 41.0 52-53 39.137125 41.0 39.0 41.0 36.0 41.0 54-55 38.889624999999995 40.0 39.0 41.0 35.5 41.0 56-57 38.963375 41.0 39.0 41.0 35.0 41.0 58-59 38.97525 41.0 39.0 41.0 35.0 41.0 60-61 38.843375 40.5 38.5 41.0 35.0 41.0 62-63 38.538 40.0 37.5 41.0 35.0 41.0 64-65 38.249625 39.5 37.0 41.0 35.0 41.0 66-67 37.899125 39.0 36.5 41.0 35.0 41.0 68-69 37.536625 39.0 36.0 41.0 34.0 41.0 70-71 37.098875 37.5 35.0 40.0 34.0 41.0 72-73 36.577124999999995 37.0 35.0 39.0 34.0 41.0 74-75 36.060875 36.5 35.0 39.0 33.0 41.0 76-77 34.202 34.5 33.0 36.5 30.0 39.0 78-79 35.127250000000004 36.0 35.0 37.0 32.5 39.0 80-81 35.019375 35.0 35.0 37.0 33.0 39.0 82-83 34.749625 35.0 35.0 36.5 33.0 37.0 84-85 34.539500000000004 35.0 35.0 36.0 33.0 37.0 86-87 34.28975 35.0 35.0 36.0 33.0 37.0 88-89 34.051625 35.0 35.0 35.5 32.5 36.0 90-91 33.906499999999994 35.0 35.0 35.0 32.5 36.0 92-93 33.741 35.0 35.0 35.0 32.0 36.0 94-95 33.7295 35.0 35.0 35.0 32.5 36.0 96-97 33.71475 35.0 35.0 35.0 32.5 36.0 98-99 33.609625 35.0 35.0 35.0 32.5 36.0 100 33.0505 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 3.0 11 2.0 12 1.0 13 0.0 14 2.0 15 1.0 16 3.0 17 2.0 18 4.0 19 2.0 20 6.0 21 3.0 22 5.0 23 3.0 24 3.0 25 8.0 26 10.0 27 7.0 28 12.0 29 14.0 30 35.0 31 29.0 32 43.0 33 48.0 34 73.0 35 122.0 36 250.0 37 783.0 38 1914.0 39 607.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.498740554156168 15.138539042821158 15.365239294710328 42.99748110831234 2 19.975 23.75 37.6 18.675 3 21.9 26.424999999999997 26.674999999999997 25.0 4 23.200000000000003 32.9 21.5 22.400000000000002 5 23.125 35.575 23.200000000000003 18.099999999999998 6 18.65 36.199999999999996 24.625 20.525 7 17.0 18.525 43.974999999999994 20.5 8 18.825 25.15 29.625 26.400000000000002 9 19.725 23.65 32.1 24.525 10-11 22.325 33.6 22.525000000000002 21.55 12-13 20.7875 26.7125 30.3 22.2 14-15 20.962500000000002 26.900000000000002 29.275000000000002 22.8625 16-17 22.425 28.9375 26.8375 21.8 18-19 21.2875 28.8375 27.8375 22.037499999999998 20-21 21.2375 28.1625 28.462500000000002 22.1375 22-23 21.55 29.45 27.5125 21.4875 24-25 21.224999999999998 30.5125 27.037499999999998 21.224999999999998 26-27 21.2875 29.212500000000002 28.037499999999998 21.462500000000002 28-29 21.5375 28.787499999999998 26.525 23.150000000000002 30-31 21.2375 28.3875 28.1375 22.237499999999997 32-33 21.837500000000002 28.0875 27.762500000000003 22.3125 34-35 22.537499999999998 27.987499999999997 27.1625 22.3125 36-37 21.775 28.787499999999998 27.462500000000002 21.975 38-39 21.587500000000002 28.287499999999998 27.8375 22.287499999999998 40-41 21.3 28.849999999999998 27.787499999999998 22.0625 42-43 21.3 27.950000000000003 29.2375 21.512500000000003 44-45 22.35 28.125 27.5125 22.0125 46-47 21.625 28.8875 27.187499999999996 22.3 48-49 20.925 29.1375 27.925 22.0125 50-51 21.2625 28.962500000000002 28.125 21.65 52-53 21.3625 28.575 27.9375 22.125 54-55 21.2875 28.6625 27.2625 22.787499999999998 56-57 22.025 28.262500000000003 28.000000000000004 21.712500000000002 58-59 21.6 28.525 28.125 21.75 60-61 21.375 28.349999999999998 27.6875 22.5875 62-63 22.037499999999998 28.237499999999997 28.3375 21.3875 64-65 21.9 28.1125 28.5875 21.4 66-67 21.4875 28.199999999999996 27.737499999999997 22.575 68-69 22.6125 28.575 27.762500000000003 21.05 70-71 22.3875 27.6 29.099999999999998 20.9125 72-73 21.837500000000002 26.950000000000003 28.525 22.6875 74-75 21.075 28.462500000000002 28.125 22.3375 76-77 21.65 28.812500000000004 28.237499999999997 21.3 78-79 22.537499999999998 27.6375 27.462500000000002 22.3625 80-81 21.2625 28.1 28.875 21.762500000000003 82-83 21.7 29.049999999999997 27.712500000000002 21.5375 84-85 21.7 28.275 28.3875 21.637500000000003 86-87 22.5 27.925 27.700000000000003 21.875 88-89 21.925 28.299999999999997 28.000000000000004 21.775 90-91 21.2 28.4 28.0875 22.3125 92-93 22.3 27.9375 27.825 21.9375 94-95 22.025 28.249999999999996 28.3125 21.4125 96-97 21.175 28.349999999999998 28.075 22.400000000000002 98-99 22.0 27.650000000000002 28.037499999999998 22.3125 100 22.13053263315829 28.782195548887223 27.68192048012003 21.405351337834457 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 2.0 23 1.0 24 1.0 25 4.5 26 9.0 27 11.5 28 14.0 29 19.5 30 24.0 31 33.0 32 46.0 33 54.0 34 58.0 35 68.5 36 99.5 37 128.5 38 136.0 39 152.5 40 187.5 41 225.0 42 230.0 43 255.0 44 276.5 45 268.0 46 251.5 47 232.5 48 227.0 49 197.0 50 160.0 51 125.5 52 108.5 53 103.0 54 71.5 55 40.5 56 33.0 57 30.5 58 22.5 59 15.0 60 17.5 61 13.0 62 9.5 63 9.0 64 5.0 65 2.0 66 2.0 67 2.5 68 3.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra Read 755898 spots for SRR3207849.sra Written 755898 spots for SRR3207849.sra Read 755888 spots for SRR3207849.sra Written 755888 spots for SRR3207849.sra SRR ids: ['SRR3207849.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gw3v4vaf SRR3207849.sra spots: 15117770 blocks: [[1, 755888], [755889, 1511776], [1511777, 2267664], [2267665, 3023552], [3023553, 3779440], [3779441, 4535328], [4535329, 5291216], [5291217, 6047104], [6047105, 6802992], [6802993, 7558880], [7558881, 8314768], [8314769, 9070656], [9070657, 9826544], [9826545, 10582432], [10582433, 11338320], [11338321, 12094208], [12094209, 12850096], [12850097, 13605984], [13605985, 14361872], [14361873, 15117770]] SRR3207849 file size 3931513 SRR3207849 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207849 SRR3207849_1.fastq Input file: SRR3207849_1.fastq trimmed: SRR3207849-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 08:51:22 2025 >> started Tue Feb 11 08:51:30 2025 >> done (7.986s) 15117770 reads processed; of these: 3186 ( 0.02%) short reads filtered out after trimming by size control 20916 ( 0.14%) empty reads filtered out after trimming by size control 15093668 (99.84%) reads available; of these: 697299 ( 4.62%) trimmed reads available after processing 14396369 (95.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 367 0.00% 19 485 0.00% 20 532 0.00% 21 706 0.00% 22 894 0.01% 23 1205 0.01% 24 1655 0.01% 25 2134 0.01% 26 2151 0.01% 27 2161 0.01% 28 2215 0.01% 29 2323 0.02% 30 2507 0.02% 31 2747 0.02% 32 2827 0.02% 33 3012 0.02% 34 3349 0.02% 35 3367 0.02% 36 3453 0.02% 37 3724 0.02% 38 3809 0.03% 39 3951 0.03% 40 3907 0.03% 41 4295 0.03% 42 4514 0.03% 43 4839 0.03% 44 5025 0.03% 45 4978 0.03% 46 5072 0.03% 47 5364 0.04% 48 5498 0.04% 49 5525 0.04% 50 5726 0.04% 51 6117 0.04% 52 5921 0.04% 53 6094 0.04% 54 6066 0.04% 55 5805 0.04% 56 6106 0.04% 57 6035 0.04% 58 6546 0.04% 59 6492 0.04% 60 6638 0.04% 61 6671 0.04% 62 6715 0.04% 63 6972 0.05% 64 7140 0.05% 65 7243 0.05% 66 7320 0.05% 67 7592 0.05% 68 7822 0.05% 69 7418 0.05% 70 7984 0.05% 71 8215 0.05% 72 8573 0.06% 73 9008 0.06% 74 9626 0.06% 75 10146 0.07% 76 4868 0.03% 77 5839 0.04% 78 6950 0.05% 79 7597 0.05% 80 8238 0.05% 81 8760 0.06% 82 9448 0.06% 83 10199 0.07% 84 10414 0.07% 85 10883 0.07% 86 11731 0.08% 87 12229 0.08% 88 13521 0.09% 89 14779 0.10% 90 15706 0.10% 91 17291 0.11% 92 19218 0.13% 93 21411 0.14% 94 24139 0.16% 95 28009 0.19% 96 31656 0.21% 97 36674 0.24% 98 40459 0.27% 99 42698 0.28% 100 14396369 95.38% 15093668 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=46.60 fanout-score-rank=6 prefix-density=0.49 prefix-fanout=33.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=167.12 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=23.3 sequence=AAGAAGAAGAAA Started job on | Feb 11 08:51:49 Started mapping on | Feb 11 08:51:49 Finished on | Feb 11 08:52:08 Mapping speed, Million of reads per hour | 2859.85 Number of input reads | 15093668 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 14040459 Uniquely mapped reads % | 93.02% Average mapped length | 98.55 Number of splices: Total | 3756234 Number of splices: Annotated (sjdb) | 3681019 Number of splices: GT/AG | 3697055 Number of splices: GC/AG | 47140 Number of splices: AT/AC | 4012 Number of splices: Non-canonical | 8027 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329290 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 94646 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 723919 723919 723919 N_multimapping 329290 329290 329290 N_noFeature 638223 7275788 7285578 N_ambiguous 165611 23806 24714 UnstrandedReadsAssigned:13236625 PositiveStrandReadsAssigned:6740865 NegativeStrandReadsAssigned:6730167 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207849 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207849-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,093,668 reads, 13,639,966 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52401 SRR3207849.ke.tsv 34699 SRR3207849.se.tsv 87100 total ==> SRR3207849.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 595 32.0941 Potri.005G024800.1.v4.1 1035 936 130 14.3764 Potri.004G059700.1.v4.1 961 862 28 3.36228 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 249.493 9.08053 Potri.016G087400.1.v4.1 270 171 730 441.886 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 43 2.65887 Potri.012G127500.1.v4.1 977 878 1203 141.826 ==> SRR3207849.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1572 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207849 completed mapping pipeline successfully