Starting /dee2/code/volunteer_pipeline.sh SRR3207850 current disk space = 3055384727552 free memory = 1578915140 SRR3207850 SRAfilesize 751ccc3847e651aa551649317dd06927 SRR3207850.sra SRR3207850.sra file validated SRR3207850 is single end SRR3207850 is conventional basespace SRR3207850 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207850_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8455 34.0 33.0 34.0 31.0 34.0 2 33.19425 34.0 34.0 34.0 31.0 34.0 3 33.4685 34.0 34.0 34.0 31.0 34.0 4 36.68975 37.0 37.0 37.0 35.0 37.0 5 36.57575 37.0 37.0 37.0 35.0 37.0 6 36.642 37.0 37.0 37.0 35.0 37.0 7 36.483 37.0 37.0 37.0 35.0 37.0 8 36.63575 37.0 37.0 37.0 35.0 37.0 9 38.57675 39.0 39.0 39.0 37.0 39.0 10-11 38.6045 39.0 39.0 39.0 38.0 39.0 12-13 38.582 39.0 39.0 39.0 38.0 39.0 14-15 40.29775 41.0 40.5 41.0 39.0 41.0 16-17 40.266875 41.0 40.0 41.0 39.0 41.0 18-19 40.280249999999995 41.0 40.0 41.0 39.0 41.0 20-21 40.255125 41.0 40.0 41.0 39.0 41.0 22-23 40.187124999999995 41.0 40.0 41.0 39.0 41.0 24-25 40.003125 41.0 40.0 41.0 38.0 41.0 26-27 39.754374999999996 41.0 40.0 41.0 38.0 41.0 28-29 39.891625000000005 41.0 40.0 41.0 38.0 41.0 30-31 39.714749999999995 41.0 40.0 41.0 38.0 41.0 32-33 39.825125 41.0 40.0 41.0 38.0 41.0 34-35 39.853125000000006 41.0 40.0 41.0 38.0 41.0 36-37 39.79725 41.0 40.0 41.0 38.0 41.0 38-39 39.62975 41.0 40.0 41.0 37.5 41.0 40-41 39.564875 41.0 40.0 41.0 37.0 41.0 42-43 39.461124999999996 41.0 40.0 41.0 37.0 41.0 44-45 39.565875000000005 41.0 40.0 41.0 37.0 41.0 46-47 39.428250000000006 41.0 40.0 41.0 37.0 41.0 48-49 39.393375 41.0 40.0 41.0 37.0 41.0 50-51 39.234625 41.0 39.0 41.0 36.0 41.0 52-53 39.089375000000004 41.0 39.0 41.0 36.0 41.0 54-55 38.940625 40.0 39.0 41.0 35.0 41.0 56-57 39.042249999999996 41.0 39.0 41.0 35.5 41.0 58-59 39.051 41.0 39.0 41.0 35.0 41.0 60-61 38.890625 40.5 38.5 41.0 35.0 41.0 62-63 38.608374999999995 40.0 37.5 41.0 35.0 41.0 64-65 38.33625 40.0 37.0 41.0 35.0 41.0 66-67 37.9525 39.0 36.5 41.0 35.0 41.0 68-69 37.618375 39.0 36.0 41.0 35.0 41.0 70-71 37.122375000000005 38.0 35.5 40.5 34.5 41.0 72-73 36.632625000000004 37.0 35.0 39.0 34.0 41.0 74-75 36.156375 37.0 35.0 39.0 34.0 40.5 76-77 34.236125 34.5 33.0 36.5 30.0 39.0 78-79 35.214124999999996 36.0 35.0 37.0 32.5 39.0 80-81 35.081375 35.0 35.0 37.0 33.0 39.0 82-83 34.803875000000005 35.0 35.0 36.5 33.0 37.0 84-85 34.60725 35.0 35.0 36.0 33.0 37.0 86-87 34.351749999999996 35.0 35.0 36.0 33.0 37.0 88-89 34.138625 35.0 35.0 35.5 33.0 36.0 90-91 33.97925 35.0 35.0 35.0 33.0 36.0 92-93 33.824124999999995 35.0 35.0 35.0 32.5 36.0 94-95 33.752250000000004 35.0 35.0 35.0 33.0 36.0 96-97 33.667375 35.0 35.0 35.0 32.5 35.5 98-99 33.5965 35.0 35.0 35.0 32.5 35.0 100 33.22425 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 3.0 12 1.0 13 1.0 14 4.0 15 3.0 16 2.0 17 2.0 18 3.0 19 1.0 20 5.0 21 2.0 22 3.0 23 6.0 24 3.0 25 10.0 26 4.0 27 13.0 28 11.0 29 15.0 30 31.0 31 31.0 32 37.0 33 52.0 34 54.0 35 113.0 36 256.0 37 799.0 38 1951.0 39 581.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.03400152245623 15.706673433138798 14.082720121796498 44.176604922608476 2 19.1 23.925 37.8 19.175 3 21.85 28.125 25.650000000000002 24.375 4 24.8 32.65 20.200000000000003 22.35 5 24.437218609304654 35.5927963981991 21.885942971485743 18.084042021010504 6 18.8 37.225 25.900000000000002 18.075 7 16.6 18.375 43.175000000000004 21.85 8 18.8 23.1 30.4 27.700000000000003 9 20.175 23.275000000000002 31.474999999999998 25.074999999999996 10-11 22.25 33.4875 22.5125 21.75 12-13 20.3125 26.075 29.675 23.9375 14-15 20.4875 27.400000000000002 29.062500000000004 23.05 16-17 22.0125 27.712500000000002 27.187499999999996 23.0875 18-19 21.8625 28.4125 27.712500000000002 22.0125 20-21 21.762500000000003 28.237499999999997 28.0625 21.9375 22-23 21.375 28.4125 27.3625 22.85 24-25 21.8875 28.237499999999997 27.8375 22.037499999999998 26-27 21.637500000000003 27.487499999999997 28.512500000000003 22.3625 28-29 22.625 27.987499999999997 27.962500000000002 21.425 30-31 21.25 29.262500000000003 27.462500000000002 22.025 32-33 21.45 27.55 29.1875 21.8125 34-35 21.3125 29.049999999999997 27.750000000000004 21.8875 36-37 21.7 28.487499999999997 27.875 21.9375 38-39 22.05 27.575 28.125 22.25 40-41 21.9 27.925 28.0875 22.0875 42-43 21.337500000000002 28.8375 27.437499999999996 22.3875 44-45 21.7375 28.999999999999996 27.437499999999996 21.825 46-47 22.5625 27.5625 27.4125 22.4625 48-49 21.2 28.4125 27.037499999999998 23.35 50-51 21.2 28.199999999999996 27.6125 22.9875 52-53 21.775 27.9375 28.65 21.637500000000003 54-55 21.4375 27.474999999999998 27.975 23.1125 56-57 21.675 28.775000000000002 27.6125 21.9375 58-59 21.8875 27.6875 27.987499999999997 22.4375 60-61 21.762500000000003 27.962500000000002 28.487499999999997 21.7875 62-63 22.15 28.349999999999998 27.1625 22.3375 64-65 21.3875 27.987499999999997 28.799999999999997 21.825 66-67 21.625 28.5625 27.700000000000003 22.112499999999997 68-69 21.712500000000002 28.225 28.012500000000003 22.05 70-71 22.3875 28.299999999999997 27.725 21.587500000000002 72-73 21.4875 28.8625 27.8625 21.7875 74-75 21.925 28.525 27.8875 21.6625 76-77 22.0125 28.199999999999996 27.35 22.4375 78-79 22.0625 27.537499999999998 28.6875 21.712500000000002 80-81 21.4875 28.6875 28.325 21.5 82-83 22.15 28.4125 27.6875 21.75 84-85 21.4375 28.449999999999996 28.425 21.6875 86-87 22.425 28.287499999999998 27.725 21.5625 88-89 21.5375 27.750000000000004 28.65 22.0625 90-91 22.475 27.775 27.487499999999997 22.2625 92-93 22.8625 29.2 27.0625 20.875 94-95 23.0125 27.237499999999997 27.737499999999997 22.0125 96-97 21.587500000000002 27.175 28.375 22.8625 98-99 22.1375 27.6375 28.012500000000003 22.2125 100 21.875 28.175 27.85 22.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 2.5 24 2.5 25 3.5 26 4.0 27 7.5 28 8.5 29 12.5 30 19.0 31 20.5 32 26.0 33 42.0 34 57.5 35 74.5 36 85.0 37 97.5 38 133.5 39 168.0 40 214.5 41 232.0 42 235.0 43 255.5 44 265.5 45 278.0 46 267.5 47 251.0 48 235.0 49 203.5 50 173.5 51 146.5 52 119.0 53 89.5 54 64.5 55 50.0 56 38.0 57 27.0 58 18.5 59 13.0 60 11.5 61 9.5 62 7.0 63 7.0 64 5.5 65 2.5 66 1.5 67 1.5 68 2.5 69 2.0 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408837 spots for SRR3207850.sra Written 1408837 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra Read 1408833 spots for SRR3207850.sra Written 1408833 spots for SRR3207850.sra SRR ids: ['SRR3207850.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2k9y9ahr SRR3207850.sra spots: 28176664 blocks: [[1, 1408833], [1408834, 2817666], [2817667, 4226499], [4226500, 5635332], [5635333, 7044165], [7044166, 8452998], [8452999, 9861831], [9861832, 11270664], [11270665, 12679497], [12679498, 14088330], [14088331, 15497163], [15497164, 16905996], [16905997, 18314829], [18314830, 19723662], [19723663, 21132495], [21132496, 22541328], [22541329, 23950161], [23950162, 25358994], [25358995, 26767827], [26767828, 28176664]] SRR3207850 file size 7336943 SRR3207850 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207850 SRR3207850_1.fastq Input file: SRR3207850_1.fastq trimmed: SRR3207850-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:10:02 2025 >> started Tue Feb 11 09:10:17 2025 >> done (14.356s) 28176664 reads processed; of these: 7517 ( 0.03%) short reads filtered out after trimming by size control 17576 ( 0.06%) empty reads filtered out after trimming by size control 28151571 (99.91%) reads available; of these: 1223924 ( 4.35%) trimmed reads available after processing 26927647 (95.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 756 0.00% 19 937 0.00% 20 1051 0.00% 21 1300 0.00% 22 1612 0.01% 23 2269 0.01% 24 2996 0.01% 25 3718 0.01% 26 3813 0.01% 27 3797 0.01% 28 4010 0.01% 29 4194 0.01% 30 4522 0.02% 31 4651 0.02% 32 4927 0.02% 33 5171 0.02% 34 5654 0.02% 35 5723 0.02% 36 6050 0.02% 37 6265 0.02% 38 6602 0.02% 39 6804 0.02% 40 7124 0.03% 41 7362 0.03% 42 7719 0.03% 43 8053 0.03% 44 8648 0.03% 45 8801 0.03% 46 8771 0.03% 47 9375 0.03% 48 9547 0.03% 49 9902 0.04% 50 9891 0.04% 51 10408 0.04% 52 10277 0.04% 53 10669 0.04% 54 10573 0.04% 55 10275 0.04% 56 10394 0.04% 57 10563 0.04% 58 11397 0.04% 59 11236 0.04% 60 11248 0.04% 61 11469 0.04% 62 11598 0.04% 63 11865 0.04% 64 12184 0.04% 65 12279 0.04% 66 12897 0.05% 67 13118 0.05% 68 13683 0.05% 69 12824 0.05% 70 13453 0.05% 71 13846 0.05% 72 14830 0.05% 73 15527 0.06% 74 16337 0.06% 75 17399 0.06% 76 8418 0.03% 77 9903 0.04% 78 11874 0.04% 79 13288 0.05% 80 14259 0.05% 81 15095 0.05% 82 16005 0.06% 83 17808 0.06% 84 18023 0.06% 85 18993 0.07% 86 19832 0.07% 87 21746 0.08% 88 23740 0.08% 89 25650 0.09% 90 27484 0.10% 91 30470 0.11% 92 33621 0.12% 93 37423 0.13% 94 43290 0.15% 95 49847 0.18% 96 56652 0.20% 97 66308 0.24% 98 74240 0.26% 99 77591 0.28% 100 26927647 95.65% 28151571 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=48.55 fanout-score-rank=6 prefix-density=0.54 prefix-fanout=34.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=285.81 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 09:10:33 Started mapping on | Feb 11 09:10:33 Finished on | Feb 11 09:11:02 Mapping speed, Million of reads per hour | 3494.68 Number of input reads | 28151571 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 26626776 Uniquely mapped reads % | 94.58% Average mapped length | 98.59 Number of splices: Total | 7750845 Number of splices: Annotated (sjdb) | 7609702 Number of splices: GT/AG | 7632603 Number of splices: GC/AG | 95583 Number of splices: AT/AC | 7511 Number of splices: Non-canonical | 15148 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 653867 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 159927 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.52% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 870928 870928 870928 N_multimapping 653867 653867 653867 N_noFeature 1143882 13808747 13781382 N_ambiguous 269341 44038 45098 UnstrandedReadsAssigned:25213553 PositiveStrandReadsAssigned:12773991 NegativeStrandReadsAssigned:12800296 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207850 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207850-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,151,571 reads, 25,964,951 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR3207850.ke.tsv 34699 SRR3207850.se.tsv 87100 total ==> SRR3207850.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 890 26.7094 Potri.005G024800.1.v4.1 1035 936 163 10.0291 Potri.004G059700.1.v4.1 961 862 21 1.40301 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 493.935 10.002 Potri.016G087400.1.v4.1 270 171 1108 373.158 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 116 3.99072 Potri.012G127500.1.v4.1 977 878 3043 199.598 ==> SRR3207850.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2015 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 403 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 28 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207850 completed mapping pipeline successfully