Starting /dee2/code/volunteer_pipeline.sh SRR3207851 current disk space = 3055763927040 free memory = 1467707168 SRR3207851 SRAfilesize df141fbc8400e4013352537c9d234a64 SRR3207851.sra SRR3207851.sra file validated SRR3207851 is single end SRR3207851 is conventional basespace SRR3207851 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207851_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85025 34.0 33.0 34.0 31.0 34.0 2 33.17925 34.0 34.0 34.0 31.0 34.0 3 33.44475 34.0 34.0 34.0 31.0 34.0 4 36.7055 37.0 37.0 37.0 35.0 37.0 5 36.59575 37.0 37.0 37.0 35.0 37.0 6 36.66525 37.0 37.0 37.0 35.0 37.0 7 36.50425 37.0 37.0 37.0 35.0 37.0 8 36.6235 37.0 37.0 37.0 35.0 37.0 9 38.603 39.0 39.0 39.0 38.0 39.0 10-11 38.60225 39.0 39.0 39.0 38.0 39.0 12-13 38.574375 39.0 39.0 39.0 38.0 39.0 14-15 40.321625 41.0 40.5 41.0 39.0 41.0 16-17 40.3195 41.0 40.0 41.0 39.0 41.0 18-19 40.291875000000005 41.0 40.0 41.0 39.0 41.0 20-21 40.314499999999995 41.0 40.0 41.0 39.0 41.0 22-23 40.19825 41.0 40.0 41.0 39.0 41.0 24-25 40.073875 41.0 40.0 41.0 38.0 41.0 26-27 39.891625000000005 41.0 40.0 41.0 38.0 41.0 28-29 39.969625 41.0 40.0 41.0 38.0 41.0 30-31 39.706500000000005 41.0 40.0 41.0 38.0 41.0 32-33 39.86125 41.0 40.0 41.0 38.0 41.0 34-35 39.826 41.0 40.0 41.0 38.0 41.0 36-37 39.759874999999994 41.0 40.0 41.0 38.0 41.0 38-39 39.639375 41.0 40.0 41.0 38.0 41.0 40-41 39.619749999999996 41.0 40.0 41.0 38.0 41.0 42-43 39.4055 41.0 40.0 41.0 37.0 41.0 44-45 39.566125 41.0 40.0 41.0 38.0 41.0 46-47 39.41825 41.0 40.0 41.0 37.0 41.0 48-49 39.392125 41.0 40.0 41.0 37.0 41.0 50-51 39.278 41.0 39.0 41.0 37.0 41.0 52-53 39.20475 41.0 39.0 41.0 36.0 41.0 54-55 38.998000000000005 41.0 39.0 41.0 36.0 41.0 56-57 39.093625 41.0 39.0 41.0 36.0 41.0 58-59 39.078375 41.0 39.0 41.0 36.0 41.0 60-61 38.879875 41.0 38.5 41.0 35.0 41.0 62-63 38.588625 40.0 37.5 41.0 35.0 41.0 64-65 38.43725 40.0 37.0 41.0 35.0 41.0 66-67 38.0725 39.0 36.5 41.0 35.0 41.0 68-69 37.68875 39.0 36.0 41.0 35.0 41.0 70-71 37.232875 38.5 35.5 40.5 34.5 41.0 72-73 36.7555 37.0 35.0 39.5 34.0 41.0 74-75 36.2845 37.0 35.0 39.0 34.0 41.0 76-77 34.387375000000006 35.5 33.0 36.5 30.0 39.0 78-79 35.294875 36.0 35.0 37.0 33.0 39.0 80-81 35.1075 35.5 35.0 37.0 33.0 39.0 82-83 34.846374999999995 35.0 35.0 36.5 33.5 37.5 84-85 34.591875 35.0 35.0 36.0 33.0 37.0 86-87 34.39375 35.0 35.0 36.0 33.0 37.0 88-89 34.183875 35.0 35.0 35.5 33.0 36.0 90-91 34.002875 35.0 35.0 35.0 33.0 36.0 92-93 33.896875 35.0 35.0 35.0 33.0 36.0 94-95 33.83225 35.0 35.0 35.0 33.0 36.0 96-97 33.740875 35.0 35.0 35.0 33.0 36.0 98-99 33.681749999999994 35.0 35.0 35.0 33.0 35.5 100 33.3455 35.0 34.0 35.0 32.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 3.0 11 4.0 12 4.0 13 2.0 14 1.0 15 3.0 16 3.0 17 0.0 18 3.0 19 3.0 20 3.0 21 3.0 22 4.0 23 1.0 24 6.0 25 7.0 26 6.0 27 9.0 28 16.0 29 19.0 30 23.0 31 23.0 32 29.0 33 33.0 34 74.0 35 100.0 36 230.0 37 785.0 38 1947.0 39 651.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.20812182741117 15.0 14.873096446700506 42.91878172588833 2 19.05 24.75 35.575 20.625 3 20.599999999999998 27.075 27.6 24.725 4 25.324999999999996 30.95 20.825 22.900000000000002 5 24.381095273818453 35.08377094273568 22.88072018004501 17.65441360340085 6 18.15 38.074999999999996 24.95 18.825 7 17.275 18.025 44.2 20.5 8 18.95 23.275000000000002 29.775000000000002 28.000000000000004 9 19.875 22.725 32.25 25.15 10-11 22.912499999999998 32.05 23.875 21.1625 12-13 20.875 27.474999999999998 28.625 23.025000000000002 14-15 21.05 27.325 28.9125 22.7125 16-17 22.0625 27.8625 28.6875 21.3875 18-19 21.8 28.549999999999997 27.725 21.925 20-21 21.5 28.5875 28.262500000000003 21.65 22-23 21.462500000000002 28.5625 27.224999999999998 22.75 24-25 21.775 29.625 27.287499999999998 21.3125 26-27 22.037499999999998 28.462500000000002 27.625 21.875 28-29 21.575 28.249999999999996 28.3375 21.837500000000002 30-31 21.1875 29.025000000000002 28.487499999999997 21.3 32-33 22.3625 28.325 27.437499999999996 21.875 34-35 21.8875 28.175 28.449999999999996 21.4875 36-37 21.5 27.425 28.537499999999998 22.537499999999998 38-39 21.0 29.299999999999997 27.3 22.400000000000002 40-41 22.650000000000002 28.499999999999996 27.762500000000003 21.087500000000002 42-43 21.75 28.249999999999996 28.3125 21.6875 44-45 22.4375 28.025 27.775 21.762500000000003 46-47 21.9375 27.737499999999997 28.262500000000003 22.0625 48-49 21.45 28.4125 28.0625 22.075 50-51 21.375 28.0625 28.8625 21.7 52-53 21.8125 28.487499999999997 27.2625 22.4375 54-55 21.45 27.6375 28.4375 22.475 56-57 21.912499999999998 27.800000000000004 28.0625 22.225 58-59 22.0625 28.212500000000002 28.175 21.55 60-61 21.625 28.975 28.037499999999998 21.3625 62-63 20.837500000000002 28.000000000000004 29.062500000000004 22.1 64-65 22.4875 27.8125 27.3625 22.3375 66-67 21.7 28.475 28.7375 21.087500000000002 68-69 21.6625 28.962500000000002 27.287499999999998 22.0875 70-71 22.037499999999998 28.4 28.712500000000002 20.849999999999998 72-73 21.1625 27.8875 28.9375 22.0125 74-75 22.25 29.075 27.575 21.099999999999998 76-77 22.35 28.0875 28.0875 21.475 78-79 21.9625 28.4125 27.962500000000002 21.6625 80-81 21.4375 28.225 28.975 21.3625 82-83 22.537499999999998 28.275 27.9125 21.275 84-85 21.9625 27.462500000000002 28.6875 21.8875 86-87 20.7875 29.45 27.6875 22.075 88-89 21.987499999999997 28.425 28.000000000000004 21.587500000000002 90-91 22.112499999999997 28.125 29.099999999999998 20.6625 92-93 22.287499999999998 27.575 28.9125 21.224999999999998 94-95 21.925 28.199999999999996 28.549999999999997 21.325 96-97 21.2625 28.525 28.487499999999997 21.725 98-99 21.224999999999998 29.299999999999997 27.750000000000004 21.725 100 22.55 28.025 27.825 21.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 4.0 25 4.5 26 6.0 27 7.0 28 11.0 29 13.5 30 22.0 31 35.5 32 40.5 33 39.0 34 61.0 35 93.0 36 105.0 37 115.0 38 143.5 39 181.5 40 201.5 41 220.5 42 238.0 43 252.0 44 268.5 45 264.5 46 260.0 47 236.5 48 204.0 49 180.5 50 162.5 51 146.0 52 116.0 53 95.5 54 71.0 55 53.5 56 36.5 57 24.5 58 19.0 59 13.0 60 12.5 61 8.5 62 7.0 63 5.5 64 4.5 65 4.0 66 1.5 67 1.0 68 1.5 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.0625 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88 0.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386569 spots for SRR3207851.sra Written 1386569 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra Read 1386563 spots for SRR3207851.sra Written 1386563 spots for SRR3207851.sra SRR ids: ['SRR3207851.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fv6386_b SRR3207851.sra spots: 27731266 blocks: [[1, 1386563], [1386564, 2773126], [2773127, 4159689], [4159690, 5546252], [5546253, 6932815], [6932816, 8319378], [8319379, 9705941], [9705942, 11092504], [11092505, 12479067], [12479068, 13865630], [13865631, 15252193], [15252194, 16638756], [16638757, 18025319], [18025320, 19411882], [19411883, 20798445], [20798446, 22185008], [22185009, 23571571], [23571572, 24958134], [24958135, 26344697], [26344698, 27731266]] SRR3207851 file size 7220806 SRR3207851 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207851 SRR3207851_1.fastq Input file: SRR3207851_1.fastq trimmed: SRR3207851-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 08:13:40 2025 >> started Tue Feb 11 08:13:54 2025 >> done (14.354s) 27731266 reads processed; of these: 6394 ( 0.02%) short reads filtered out after trimming by size control 40261 ( 0.15%) empty reads filtered out after trimming by size control 27684611 (99.83%) reads available; of these: 1252646 ( 4.52%) trimmed reads available after processing 26431965 (95.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 666 0.00% 19 883 0.00% 20 978 0.00% 21 1168 0.00% 22 1564 0.01% 23 2169 0.01% 24 2903 0.01% 25 3748 0.01% 26 3814 0.01% 27 3886 0.01% 28 4106 0.01% 29 4278 0.02% 30 4522 0.02% 31 4679 0.02% 32 5067 0.02% 33 5078 0.02% 34 5684 0.02% 35 5916 0.02% 36 5999 0.02% 37 6464 0.02% 38 6598 0.02% 39 7043 0.03% 40 7171 0.03% 41 7515 0.03% 42 8145 0.03% 43 8361 0.03% 44 8907 0.03% 45 8856 0.03% 46 9061 0.03% 47 9656 0.03% 48 9769 0.04% 49 9950 0.04% 50 10127 0.04% 51 10766 0.04% 52 10577 0.04% 53 10933 0.04% 54 10768 0.04% 55 10624 0.04% 56 10868 0.04% 57 10935 0.04% 58 11801 0.04% 59 11315 0.04% 60 11807 0.04% 61 12072 0.04% 62 12231 0.04% 63 12317 0.04% 64 12632 0.05% 65 12776 0.05% 66 13183 0.05% 67 13743 0.05% 68 13882 0.05% 69 13383 0.05% 70 14369 0.05% 71 14634 0.05% 72 15344 0.06% 73 16132 0.06% 74 16930 0.06% 75 18037 0.07% 76 8739 0.03% 77 10353 0.04% 78 12460 0.05% 79 13746 0.05% 80 14997 0.05% 81 15514 0.06% 82 17014 0.06% 83 18335 0.07% 84 18504 0.07% 85 19677 0.07% 86 20447 0.07% 87 21884 0.08% 88 24582 0.09% 89 26404 0.10% 90 28343 0.10% 91 31033 0.11% 92 34778 0.13% 93 38358 0.14% 94 44242 0.16% 95 50665 0.18% 96 57340 0.21% 97 66682 0.24% 98 74025 0.27% 99 77734 0.28% 100 26431965 95.48% 27684611 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=56.68 fanout-score-rank=8 prefix-density=0.58 prefix-fanout=38.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=269.03 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=29.5 sequence=TTCTTCTTCTTT Started job on | Feb 11 08:14:13 Started mapping on | Feb 11 08:14:13 Finished on | Feb 11 08:14:47 Mapping speed, Million of reads per hour | 2931.31 Number of input reads | 27684611 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 25842922 Uniquely mapped reads % | 93.35% Average mapped length | 98.56 Number of splices: Total | 7362540 Number of splices: Annotated (sjdb) | 7224106 Number of splices: GT/AG | 7249386 Number of splices: GC/AG | 91316 Number of splices: AT/AC | 7261 Number of splices: Non-canonical | 14577 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 631566 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 133226 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1210123 1210123 1210123 N_multimapping 631566 631566 631566 N_noFeature 1145940 13405380 13403425 N_ambiguous 266247 42947 43582 UnstrandedReadsAssigned:24430735 PositiveStrandReadsAssigned:12394595 NegativeStrandReadsAssigned:12395915 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207851 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207851-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,684,611 reads, 25,132,160 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR3207851.ke.tsv 34699 SRR3207851.se.tsv 87100 total ==> SRR3207851.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 864 25.9046 Potri.005G024800.1.v4.1 1035 936 164 10.0811 Potri.004G059700.1.v4.1 961 862 20 1.33494 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 455.808 9.22125 Potri.016G087400.1.v4.1 270 171 1066 358.673 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 110 3.78073 Potri.012G127500.1.v4.1 977 878 3624 237.482 ==> SRR3207851.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1970 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 457 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207851 completed mapping pipeline successfully