Starting /dee2/code/volunteer_pipeline.sh SRR3207852 current disk space = 3055747256320 free memory = 1419550448 SRR3207852 SRAfilesize d32ad72bdaa2ddca3517d6d0f7997161 SRR3207852.sra SRR3207852.sra file validated SRR3207852 is single end SRR3207852 is conventional basespace SRR3207852 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207852_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99725 34.0 33.0 34.0 31.0 34.0 2 33.28975 34.0 34.0 34.0 31.0 34.0 3 33.49 34.0 34.0 34.0 31.0 34.0 4 36.71725 37.0 37.0 37.0 37.0 37.0 5 36.63525 37.0 37.0 37.0 35.0 37.0 6 36.6915 37.0 37.0 37.0 36.0 37.0 7 36.52175 37.0 37.0 37.0 35.0 37.0 8 36.6515 37.0 37.0 37.0 35.0 37.0 9 38.57 39.0 39.0 39.0 38.0 39.0 10-11 38.612625 39.0 39.0 39.0 38.0 39.0 12-13 38.59275 39.0 39.0 39.0 38.0 39.0 14-15 40.330875 41.0 40.5 41.0 39.0 41.0 16-17 40.293 41.0 40.0 41.0 39.0 41.0 18-19 40.306125 41.0 40.5 41.0 39.0 41.0 20-21 40.275375 41.0 40.0 41.0 39.0 41.0 22-23 40.241125 41.0 40.0 41.0 39.0 41.0 24-25 40.06125 41.0 40.0 41.0 38.0 41.0 26-27 39.8465 41.0 40.0 41.0 38.0 41.0 28-29 39.963750000000005 41.0 40.0 41.0 38.0 41.0 30-31 39.793499999999995 41.0 40.0 41.0 38.0 41.0 32-33 39.896375 41.0 40.0 41.0 38.0 41.0 34-35 39.8575 41.0 40.0 41.0 38.0 41.0 36-37 39.75675 41.0 40.0 41.0 38.0 41.0 38-39 39.645624999999995 41.0 40.0 41.0 38.0 41.0 40-41 39.577 41.0 40.0 41.0 37.5 41.0 42-43 39.39475 41.0 40.0 41.0 37.0 41.0 44-45 39.468125 41.0 40.0 41.0 37.0 41.0 46-47 39.3885 41.0 40.0 41.0 37.0 41.0 48-49 39.405249999999995 41.0 40.0 41.0 37.0 41.0 50-51 39.27075000000001 41.0 39.0 41.0 37.0 41.0 52-53 39.110875 41.0 39.0 41.0 36.0 41.0 54-55 38.860749999999996 40.0 39.0 41.0 35.5 41.0 56-57 38.965374999999995 41.0 39.0 41.0 35.5 41.0 58-59 38.998374999999996 41.0 39.0 41.0 35.5 41.0 60-61 38.876375 41.0 39.0 41.0 35.0 41.0 62-63 38.597750000000005 40.0 37.5 41.0 35.0 41.0 64-65 38.32175 40.0 37.0 41.0 35.0 41.0 66-67 37.973 39.0 37.0 41.0 35.0 41.0 68-69 37.610125 39.0 36.0 41.0 35.0 41.0 70-71 37.197500000000005 38.0 35.5 40.5 34.5 41.0 72-73 36.638875 37.0 35.0 39.5 34.0 41.0 74-75 36.1435 37.0 35.0 39.0 34.0 41.0 76-77 34.257125 34.5 33.0 36.5 30.5 39.0 78-79 35.176125 36.0 35.0 37.0 33.0 39.0 80-81 35.001125 35.0 35.0 37.0 33.5 39.0 82-83 34.730875 35.0 35.0 36.5 34.0 38.0 84-85 34.45075 35.0 35.0 36.0 33.0 37.0 86-87 34.262625 35.0 35.0 36.0 33.0 37.0 88-89 34.046499999999995 35.0 35.0 35.5 33.0 36.0 90-91 33.8895 35.0 35.0 35.0 33.0 36.0 92-93 33.830124999999995 35.0 35.0 35.0 33.0 36.0 94-95 33.7485 35.0 35.0 35.0 33.0 36.0 96-97 33.664125 35.0 35.0 35.0 33.0 36.0 98-99 33.574124999999995 35.0 35.0 35.0 33.0 35.0 100 33.09025 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 3.0 10 1.0 11 2.0 12 3.0 13 3.0 14 1.0 15 5.0 16 3.0 17 6.0 18 1.0 19 8.0 20 8.0 21 7.0 22 3.0 23 3.0 24 2.0 25 7.0 26 7.0 27 11.0 28 15.0 29 12.0 30 11.0 31 21.0 32 31.0 33 41.0 34 64.0 35 113.0 36 238.0 37 785.0 38 1941.0 39 643.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.079646017699115 15.625790139064474 13.90644753476612 43.388116308470295 2 19.75 25.674999999999997 37.0 17.575 3 20.95 27.400000000000002 27.3 24.349999999999998 4 24.05 34.0 19.950000000000003 22.0 5 24.65 35.325 21.65 18.375 6 18.675 38.85 24.625 17.849999999999998 7 16.525000000000002 17.974999999999998 44.224999999999994 21.275 8 19.85 23.674999999999997 28.999999999999996 27.474999999999998 9 19.85 23.375 31.225 25.55 10-11 22.6375 33.4625 22.675 21.224999999999998 12-13 20.1 26.8 29.9875 23.1125 14-15 21.3 26.9625 30.225 21.512500000000003 16-17 21.875 28.5625 27.0625 22.5 18-19 20.6375 28.0625 28.3375 22.9625 20-21 21.75 28.5875 28.1 21.5625 22-23 21.5375 28.0875 29.275000000000002 21.099999999999998 24-25 21.825 29.312500000000004 26.775 22.0875 26-27 21.9 28.050000000000004 28.3375 21.712500000000002 28-29 21.25 28.037499999999998 27.900000000000002 22.8125 30-31 21.25 28.225 27.675 22.85 32-33 22.575 28.549999999999997 27.975 20.9 34-35 22.625 28.15 27.400000000000002 21.825 36-37 20.775 27.825 28.325 23.075000000000003 38-39 22.05 27.6 28.462500000000002 21.8875 40-41 21.4375 28.1625 28.1875 22.2125 42-43 20.674999999999997 28.762500000000003 28.749999999999996 21.8125 44-45 21.1375 27.825 28.925 22.112499999999997 46-47 22.325 27.962500000000002 27.224999999999998 22.4875 48-49 21.3 28.65 27.6 22.45 50-51 21.6 27.737499999999997 28.1 22.5625 52-53 21.875 28.9 27.650000000000002 21.575 54-55 22.1 27.55 27.962500000000002 22.3875 56-57 21.05 28.9125 28.8625 21.175 58-59 21.525 29.075 28.1 21.3 60-61 21.525 28.625 28.762500000000003 21.087500000000002 62-63 22.25 28.4 27.5875 21.762500000000003 64-65 21.575 29.049999999999997 28.1875 21.1875 66-67 21.475 28.299999999999997 28.0625 22.162499999999998 68-69 21.4375 27.287499999999998 28.825 22.45 70-71 20.7 29.049999999999997 28.825 21.425 72-73 22.5875 27.8875 27.8875 21.637500000000003 74-75 22.075 28.125 28.262500000000003 21.5375 76-77 21.975 28.287499999999998 27.725 22.0125 78-79 21.8625 27.575 28.675 21.8875 80-81 21.9 27.650000000000002 29.1125 21.337500000000002 82-83 21.3 28.287499999999998 28.0625 22.35 84-85 21.575 27.975 28.1875 22.2625 86-87 21.65 27.762500000000003 28.15 22.4375 88-89 22.2 28.375 27.737499999999997 21.6875 90-91 21.6125 28.199999999999996 28.599999999999998 21.587500000000002 92-93 22.3875 28.575 28.287499999999998 20.75 94-95 22.0 27.575 28.762500000000003 21.6625 96-97 20.962500000000002 28.15 28.1875 22.7 98-99 23.05 28.6375 26.724999999999998 21.587500000000002 100 22.225 28.375 27.650000000000002 21.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.5 23 2.5 24 1.0 25 3.0 26 6.5 27 9.0 28 9.0 29 14.0 30 23.5 31 29.0 32 43.0 33 55.5 34 63.0 35 76.5 36 99.5 37 117.0 38 138.5 39 178.5 40 206.0 41 229.5 42 255.0 43 255.0 44 266.0 45 259.5 46 243.5 47 235.0 48 220.5 49 197.5 50 153.0 51 127.5 52 108.5 53 86.0 54 62.5 55 46.0 56 36.0 57 27.0 58 21.5 59 18.5 60 13.5 61 6.5 62 7.5 63 11.0 64 8.0 65 5.5 66 6.5 67 4.5 68 0.5 69 1.0 70 1.0 71 1.0 72 1.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2508151492350138 0.5 3 0.0 0.0 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016642 spots for SRR3207852.sra Written 1016642 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra Read 1016626 spots for SRR3207852.sra Written 1016626 spots for SRR3207852.sra SRR ids: ['SRR3207852.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sjyds17q SRR3207852.sra spots: 20332536 blocks: [[1, 1016626], [1016627, 2033252], [2033253, 3049878], [3049879, 4066504], [4066505, 5083130], [5083131, 6099756], [6099757, 7116382], [7116383, 8133008], [8133009, 9149634], [9149635, 10166260], [10166261, 11182886], [11182887, 12199512], [12199513, 13216138], [13216139, 14232764], [14232765, 15249390], [15249391, 16266016], [16266017, 17282642], [17282643, 18299268], [18299269, 19315894], [19315895, 20332536]] SRR3207852 file size 5291349 SRR3207852 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207852 SRR3207852_1.fastq Input file: SRR3207852_1.fastq trimmed: SRR3207852-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 08:41:21 2025 >> started Tue Feb 11 08:41:31 2025 >> done (10.685s) 20332536 reads processed; of these: 4518 ( 0.02%) short reads filtered out after trimming by size control 28396 ( 0.14%) empty reads filtered out after trimming by size control 20299622 (99.84%) reads available; of these: 905898 ( 4.46%) trimmed reads available after processing 19393724 (95.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 477 0.00% 19 585 0.00% 20 708 0.00% 21 874 0.00% 22 1098 0.01% 23 1547 0.01% 24 2153 0.01% 25 2655 0.01% 26 2761 0.01% 27 2705 0.01% 28 2862 0.01% 29 3054 0.02% 30 3187 0.02% 31 3349 0.02% 32 3589 0.02% 33 3861 0.02% 34 4101 0.02% 35 4343 0.02% 36 4417 0.02% 37 4634 0.02% 38 4925 0.02% 39 5007 0.02% 40 5202 0.03% 41 5509 0.03% 42 5858 0.03% 43 6055 0.03% 44 6510 0.03% 45 6535 0.03% 46 6647 0.03% 47 7187 0.04% 48 7163 0.04% 49 7343 0.04% 50 7369 0.04% 51 7702 0.04% 52 7745 0.04% 53 7956 0.04% 54 7948 0.04% 55 7772 0.04% 56 7811 0.04% 57 7889 0.04% 58 8506 0.04% 59 8294 0.04% 60 8581 0.04% 61 8773 0.04% 62 8896 0.04% 63 9067 0.04% 64 9343 0.05% 65 9394 0.05% 66 9523 0.05% 67 9946 0.05% 68 10142 0.05% 69 9591 0.05% 70 10259 0.05% 71 10715 0.05% 72 11255 0.06% 73 11838 0.06% 74 12379 0.06% 75 13157 0.06% 76 6392 0.03% 77 7646 0.04% 78 8940 0.04% 79 10069 0.05% 80 10688 0.05% 81 11351 0.06% 82 11976 0.06% 83 13233 0.07% 84 13505 0.07% 85 14315 0.07% 86 14587 0.07% 87 16079 0.08% 88 17664 0.09% 89 18911 0.09% 90 20609 0.10% 91 22374 0.11% 92 24817 0.12% 93 27942 0.14% 94 31481 0.16% 95 36510 0.18% 96 40908 0.20% 97 47876 0.24% 98 53689 0.26% 99 55584 0.27% 100 19393724 95.54% 20299622 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=53.78 fanout-score-rank=7 prefix-density=0.61 prefix-fanout=36.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=277.17 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=29.9 sequence=TTCTTCTTCTTT Started job on | Feb 11 08:41:50 Started mapping on | Feb 11 08:41:50 Finished on | Feb 11 08:42:14 Mapping speed, Million of reads per hour | 3044.94 Number of input reads | 20299622 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19036179 Uniquely mapped reads % | 93.78% Average mapped length | 98.56 Number of splices: Total | 5388215 Number of splices: Annotated (sjdb) | 5286102 Number of splices: GT/AG | 5305598 Number of splices: GC/AG | 66258 Number of splices: AT/AC | 5286 Number of splices: Non-canonical | 11073 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465450 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 114642 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 797993 797993 797993 N_multimapping 465450 465450 465450 N_noFeature 847403 9881207 9866884 N_ambiguous 198847 31654 31966 UnstrandedReadsAssigned:17989929 PositiveStrandReadsAssigned:9123318 NegativeStrandReadsAssigned:9137329 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207852 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207852-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,299,622 reads, 18,521,169 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR3207852.ke.tsv 34699 SRR3207852.se.tsv 87100 total ==> SRR3207852.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 645 26.5267 Potri.005G024800.1.v4.1 1035 936 90 7.58867 Potri.004G059700.1.v4.1 961 862 13 1.19024 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 344.88 9.57055 Potri.016G087400.1.v4.1 270 171 810 373.842 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 74 3.48879 Potri.012G127500.1.v4.1 977 878 2402 215.912 ==> SRR3207852.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1611 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 309 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207852 completed mapping pipeline successfully