Starting /dee2/code/volunteer_pipeline.sh SRR3207853 current disk space = 3055712264192 free memory = 1413276456 SRR3207853 SRAfilesize 1fa8de7b27993994f2fe48739080e67a SRR3207853.sra SRR3207853.sra file validated SRR3207853 is single end SRR3207853 is conventional basespace SRR3207853 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207853_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98425 34.0 31.0 34.0 31.0 34.0 2 33.11 34.0 33.0 34.0 31.0 34.0 3 33.1735 34.0 34.0 34.0 31.0 34.0 4 36.56375 37.0 37.0 37.0 35.0 37.0 5 36.5085 37.0 37.0 37.0 35.0 37.0 6 36.48025 37.0 37.0 37.0 35.0 37.0 7 36.46025 37.0 37.0 37.0 35.0 37.0 8 36.44075 37.0 37.0 37.0 35.0 37.0 9 38.203 39.0 39.0 39.0 37.0 39.0 10-11 38.09875 39.0 38.5 39.0 36.0 39.0 12-13 38.176 39.0 39.0 39.0 37.0 39.0 14-15 39.799625 41.0 40.0 41.0 37.5 41.0 16-17 39.75475 41.0 40.0 41.0 37.5 41.0 18-19 39.70925 41.0 40.0 41.0 37.0 41.0 20-21 39.7 41.0 40.0 41.0 37.0 41.0 22-23 39.623000000000005 41.0 40.0 41.0 37.0 41.0 24-25 39.572625 41.0 40.0 41.0 37.0 41.0 26-27 39.413624999999996 41.0 39.5 41.0 36.5 41.0 28-29 39.135000000000005 41.0 39.0 41.0 36.0 41.0 30-31 38.832125 41.0 39.0 41.0 35.0 41.0 32-33 39.059625 41.0 39.0 41.0 35.5 41.0 34-35 39.170375 41.0 39.0 41.0 36.0 41.0 36-37 39.204499999999996 41.0 39.0 41.0 36.0 41.0 38-39 38.91375 40.5 39.0 41.0 35.5 41.0 40-41 38.913375 40.0 39.0 41.0 35.0 41.0 42-43 38.70425 40.0 38.5 41.0 34.5 41.0 44-45 38.86125 40.0 39.0 41.0 35.0 41.0 46-47 38.635374999999996 40.5 38.5 41.0 34.5 41.0 48-49 38.62675 40.0 38.5 41.0 35.0 41.0 50-51 38.548375 40.0 38.5 41.0 34.5 41.0 52-53 38.3955 40.0 38.0 41.0 34.0 41.0 54-55 37.966375 40.0 38.0 41.0 33.5 41.0 56-57 38.0115 40.0 38.0 41.0 33.0 41.0 58-59 37.863749999999996 40.0 37.5 41.0 33.5 41.0 60-61 37.394875 39.5 37.0 41.0 33.0 41.0 62-63 37.165625 39.0 36.0 41.0 32.0 41.0 64-65 36.905249999999995 39.0 36.0 40.5 32.0 41.0 66-67 36.385875 38.5 35.0 40.0 31.5 41.0 68-69 36.0325 37.5 35.0 40.0 31.0 41.0 70-71 35.535375 37.0 35.0 39.0 31.0 41.0 72-73 35.198125 37.0 35.0 39.0 30.5 40.5 74-75 34.75875 36.0 34.5 38.5 30.0 40.0 76-77 33.816125 35.0 33.5 37.0 29.5 39.0 78-79 33.902249999999995 35.0 34.0 37.0 29.5 39.0 80-81 33.363 35.0 34.0 36.0 29.0 37.5 82-83 32.949875 35.0 34.0 36.0 28.5 37.0 84-85 32.788125 35.0 34.0 36.0 28.5 37.0 86-87 32.767375 35.0 34.0 35.0 29.0 36.0 88-89 32.2905 35.0 33.5 35.0 27.5 36.0 90-91 32.21875 35.0 33.0 35.0 27.5 36.0 92-93 32.141375 35.0 33.0 35.0 27.5 36.0 94-95 32.057625 35.0 33.0 35.0 28.5 35.0 96-97 31.234 34.0 32.0 35.0 25.0 35.0 98-99 31.278875 34.0 33.0 35.0 25.0 35.0 100 31.17725 34.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 4.0 10 2.0 11 3.0 12 3.0 13 5.0 14 10.0 15 6.0 16 4.0 17 5.0 18 8.0 19 17.0 20 14.0 21 5.0 22 11.0 23 9.0 24 16.0 25 10.0 26 25.0 27 23.0 28 35.0 29 41.0 30 46.0 31 54.0 32 75.0 33 95.0 34 99.0 35 174.0 36 359.0 37 863.0 38 1668.0 39 309.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.825 15.775 13.625000000000002 42.775 2 19.725 25.924999999999997 36.6 17.75 3 20.38009502375594 27.881970492623154 27.981995498874717 23.755938984746187 4 22.45 34.599999999999994 21.45 21.5 5 24.075 34.275 23.05 18.6 6 19.1 37.45 24.7 18.75 7 16.7 18.85 42.925000000000004 21.525 8 19.025 23.275000000000002 30.599999999999998 27.1 9 20.5 23.175 30.85 25.474999999999998 10-11 22.675 33.8125 22.625 20.8875 12-13 20.125 26.974999999999998 30.225 22.675 14-15 21.040130016252032 26.815851981497683 29.391173896737094 22.75284410551319 16-17 22.25 27.9375 27.85 21.9625 18-19 21.212500000000002 28.0625 27.750000000000004 22.975 20-21 21.675 27.200000000000003 28.3125 22.8125 22-23 21.2 28.287499999999998 28.287499999999998 22.225 24-25 21.4875 28.925 27.1625 22.425 26-27 21.1875 28.3625 28.1125 22.3375 28-29 22.7125 28.262500000000003 27.287499999999998 21.7375 30-31 21.212500000000002 28.7 27.3375 22.75 32-33 21.8125 28.499999999999996 27.325 22.3625 34-35 22.400000000000002 28.7375 27.0125 21.85 36-37 21.675 27.800000000000004 27.987499999999997 22.537499999999998 38-39 22.0875 28.4 27.212500000000002 22.3 40-41 21.9625 29.062500000000004 28.075 20.9 42-43 21.837500000000002 27.975 28.625 21.5625 44-45 21.1375 28.325 28.1875 22.35 46-47 21.1875 28.725 27.1125 22.975 48-49 22.175 28.3625 27.2625 22.2 50-51 21.823411705852926 28.001500750375186 28.214107053526767 21.96098049024512 52-53 22.886443221610804 28.076538269134566 27.838919459729865 21.198099049524764 54-55 20.925 28.262500000000003 28.5625 22.25 56-57 22.112499999999997 28.1875 28.15 21.55 58-59 21.925 27.85 28.175 22.05 60-61 22.25 27.500000000000004 28.599999999999998 21.65 62-63 21.1125 28.625 27.9375 22.325 64-65 21.675 28.249999999999996 28.225 21.85 66-67 21.462500000000002 27.6125 28.3875 22.537499999999998 68-69 22.025 27.975 27.487499999999997 22.5125 70-71 21.9625 28.999999999999996 27.712500000000002 21.325 72-73 21.5625 27.775 28.575 22.0875 74-75 21.099999999999998 28.5875 28.512500000000003 21.8 76-77 21.8 28.15 27.85 22.2 78-79 21.2625 28.3875 27.700000000000003 22.650000000000002 80-81 22.8125 28.4125 27.85 20.925 82-83 22.15 28.349999999999998 28.1125 21.3875 84-85 22.15 27.750000000000004 28.487499999999997 21.6125 86-87 21.627703462932867 28.366045755719465 27.69096137017127 22.315289411176398 88-89 21.920720270101288 28.085532074527947 28.310616481180446 21.683131174190322 90-91 22.061030515257627 28.5767883941971 28.40170085042521 20.96048024012006 92-93 22.825 27.200000000000003 28.287499999999998 21.6875 94-95 22.175 27.950000000000003 28.287499999999998 21.587500000000002 96-97 21.6 28.925 28.262500000000003 21.212500000000002 98-99 21.475 28.1875 28.625 21.712500000000002 100 21.875 28.175 28.7 21.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 2.5 25 4.5 26 8.5 27 10.0 28 14.5 29 21.0 30 24.0 31 28.0 32 32.0 33 45.0 34 57.0 35 68.5 36 92.5 37 110.5 38 130.0 39 171.5 40 207.0 41 216.5 42 227.0 43 257.5 44 272.5 45 279.0 46 273.0 47 244.5 48 225.5 49 199.5 50 158.0 51 128.5 52 107.5 53 89.5 54 65.5 55 46.0 56 39.0 57 28.0 58 24.5 59 18.0 60 10.5 61 10.5 62 8.5 63 5.0 64 6.0 65 6.5 66 6.0 67 4.0 68 2.0 69 1.0 70 0.0 71 0.5 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.05 52-53 0.05 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0375 90-91 0.05 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82438534872053 99.47500000000001 2 0.1254390366281987 0.25 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025087807325639738 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 8 0.2 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966312 spots for SRR3207853.sra Written 966312 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra Read 966298 spots for SRR3207853.sra Written 966298 spots for SRR3207853.sra SRR ids: ['SRR3207853.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_faij6o16 SRR3207853.sra spots: 19325974 blocks: [[1, 966298], [966299, 1932596], [1932597, 2898894], [2898895, 3865192], [3865193, 4831490], [4831491, 5797788], [5797789, 6764086], [6764087, 7730384], [7730385, 8696682], [8696683, 9662980], [9662981, 10629278], [10629279, 11595576], [11595577, 12561874], [12561875, 13528172], [13528173, 14494470], [14494471, 15460768], [15460769, 16427066], [16427067, 17393364], [17393365, 18359662], [18359663, 19325974]] SRR3207853 file size 5018661 SRR3207853 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207853 SRR3207853_1.fastq Input file: SRR3207853_1.fastq trimmed: SRR3207853-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 08:27:23 2025 >> started Tue Feb 11 08:27:33 2025 >> done (9.828s) 19325974 reads processed; of these: 3602 ( 0.02%) short reads filtered out after trimming by size control 24801 ( 0.13%) empty reads filtered out after trimming by size control 19297571 (99.85%) reads available; of these: 1897458 ( 9.83%) trimmed reads available after processing 17400113 (90.17%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 638 0.00% 19 749 0.00% 20 922 0.00% 21 1227 0.01% 22 1668 0.01% 23 2195 0.01% 24 2737 0.01% 25 3722 0.02% 26 3670 0.02% 27 3472 0.02% 28 3669 0.02% 29 3752 0.02% 30 3565 0.02% 31 3709 0.02% 32 3695 0.02% 33 3918 0.02% 34 4153 0.02% 35 4499 0.02% 36 4820 0.02% 37 5103 0.03% 38 5295 0.03% 39 5493 0.03% 40 5978 0.03% 41 6167 0.03% 42 6589 0.03% 43 7133 0.04% 44 7491 0.04% 45 7794 0.04% 46 8022 0.04% 47 8719 0.05% 48 9345 0.05% 49 9814 0.05% 50 10514 0.05% 51 10691 0.06% 52 10879 0.06% 53 11845 0.06% 54 12970 0.07% 55 13304 0.07% 56 14111 0.07% 57 14423 0.07% 58 14989 0.08% 59 15005 0.08% 60 15620 0.08% 61 15234 0.08% 62 15483 0.08% 63 15545 0.08% 64 15621 0.08% 65 16306 0.08% 66 16359 0.08% 67 17121 0.09% 68 17426 0.09% 69 17447 0.09% 70 17950 0.09% 71 18511 0.10% 72 19195 0.10% 73 19631 0.10% 74 19836 0.10% 75 19667 0.10% 76 14452 0.07% 77 16638 0.09% 78 19078 0.10% 79 20975 0.11% 80 23055 0.12% 81 24845 0.13% 82 26694 0.14% 83 29057 0.15% 84 29502 0.15% 85 32923 0.17% 86 35136 0.18% 87 36937 0.19% 88 40063 0.21% 89 42802 0.22% 90 48469 0.25% 91 55104 0.29% 92 60858 0.32% 93 69516 0.36% 94 81344 0.42% 95 95739 0.50% 96 111278 0.58% 97 131360 0.68% 98 147907 0.77% 99 148320 0.77% 100 17400113 90.17% 19297571 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=6.91 fanout-score-rank=18 prefix-density=0.04 prefix-fanout=6.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=213.72 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=24.6 sequence=AAGAAGAAGAAA Started job on | Feb 11 08:27:53 Started mapping on | Feb 11 08:27:53 Finished on | Feb 11 08:28:18 Mapping speed, Million of reads per hour | 2778.85 Number of input reads | 19297571 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 18116246 Uniquely mapped reads % | 93.88% Average mapped length | 97.96 Number of splices: Total | 5209713 Number of splices: Annotated (sjdb) | 5107364 Number of splices: GT/AG | 5131908 Number of splices: GC/AG | 63134 Number of splices: AT/AC | 5303 Number of splices: Non-canonical | 9368 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422619 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 65162 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 758706 758706 758706 N_multimapping 422619 422619 422619 N_noFeature 854612 9398515 9440116 N_ambiguous 193591 30642 30963 UnstrandedReadsAssigned:17068043 PositiveStrandReadsAssigned:8687089 NegativeStrandReadsAssigned:8645167 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207853 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207853-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,297,571 reads, 17,484,072 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR3207853.ke.tsv 34699 SRR3207853.se.tsv 87100 total ==> SRR3207853.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 661 29.1396 Potri.005G024800.1.v4.1 1035 936 147 13.2861 Potri.004G059700.1.v4.1 961 862 32 3.14051 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 311.979 9.28013 Potri.016G087400.1.v4.1 270 171 620 306.728 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 54 2.72895 Potri.012G127500.1.v4.1 977 878 1744 168.039 ==> SRR3207853.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1164 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 342 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207853 completed mapping pipeline successfully