Starting /dee2/code/volunteer_pipeline.sh SRR3207854 current disk space = 3055760003072 free memory = 1483302636 SRR3207854 SRAfilesize 87bc504f10982af48aa535b46e3a7c53 SRR3207854.sra SRR3207854.sra file validated SRR3207854 is single end SRR3207854 is conventional basespace SRR3207854 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207854_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9755 34.0 31.0 34.0 31.0 34.0 2 33.11325 34.0 33.0 34.0 31.0 34.0 3 33.22625 34.0 34.0 34.0 31.0 34.0 4 36.50575 37.0 37.0 37.0 35.0 37.0 5 36.44925 37.0 37.0 37.0 35.0 37.0 6 36.39 37.0 37.0 37.0 35.0 37.0 7 36.43275 37.0 37.0 37.0 35.0 37.0 8 36.4355 37.0 37.0 37.0 35.0 37.0 9 38.21325 39.0 39.0 39.0 37.0 39.0 10-11 38.088375 39.0 38.5 39.0 36.0 39.0 12-13 38.14325 39.0 39.0 39.0 37.0 39.0 14-15 39.721125 41.0 40.0 41.0 37.0 41.0 16-17 39.74975 41.0 40.0 41.0 37.0 41.0 18-19 39.68925 41.0 40.0 41.0 37.0 41.0 20-21 39.649125 41.0 40.0 41.0 37.0 41.0 22-23 39.652375 41.0 40.0 41.0 37.0 41.0 24-25 39.529875000000004 41.0 40.0 41.0 37.0 41.0 26-27 39.41675 41.0 39.5 41.0 36.5 41.0 28-29 39.227375 41.0 39.0 41.0 36.0 41.0 30-31 38.801 40.5 39.0 41.0 35.0 41.0 32-33 39.011125 41.0 39.0 41.0 35.5 41.0 34-35 39.2375 41.0 39.0 41.0 36.0 41.0 36-37 39.29675 41.0 39.0 41.0 36.0 41.0 38-39 38.911625 40.5 39.0 41.0 35.0 41.0 40-41 38.95425 40.5 39.0 41.0 35.0 41.0 42-43 38.790875 40.0 39.0 41.0 35.0 41.0 44-45 38.924875 40.0 39.0 41.0 35.0 41.0 46-47 38.799499999999995 40.5 38.5 41.0 35.0 41.0 48-49 38.7205 40.0 39.0 41.0 35.0 41.0 50-51 38.703 40.0 39.0 41.0 35.0 41.0 52-53 38.506625 40.0 38.0 41.0 35.0 41.0 54-55 38.033375 40.0 38.0 41.0 33.5 41.0 56-57 38.039 40.0 38.0 41.0 34.0 41.0 58-59 37.931625 40.0 37.5 41.0 34.0 41.0 60-61 37.505250000000004 40.0 36.5 41.0 33.0 41.0 62-63 37.31625 39.0 36.0 41.0 33.0 41.0 64-65 37.1185 39.0 36.0 41.0 32.5 41.0 66-67 36.508250000000004 38.5 35.5 40.0 31.5 41.0 68-69 36.14375 37.5 35.0 40.0 31.0 41.0 70-71 35.683125000000004 37.0 35.0 39.0 31.0 41.0 72-73 35.4365 36.5 35.0 39.0 31.0 40.5 74-75 35.011125 36.0 35.0 38.5 31.0 40.0 76-77 33.986875 35.0 33.5 37.0 29.5 39.0 78-79 34.081125 35.0 34.0 37.0 30.0 39.0 80-81 33.636625 35.0 34.0 36.5 29.0 37.5 82-83 33.317625 35.0 34.0 36.0 29.0 37.0 84-85 33.164249999999996 35.0 34.0 36.0 29.0 37.0 86-87 33.068124999999995 35.0 34.0 35.0 29.5 36.5 88-89 32.59325 35.0 33.5 35.0 28.0 36.0 90-91 32.503125 35.0 34.0 35.0 28.5 36.0 92-93 32.437 35.0 34.0 35.0 29.0 35.5 94-95 32.320750000000004 35.0 33.5 35.0 29.0 35.0 96-97 31.55 34.0 32.5 35.0 25.0 35.0 98-99 31.68875 35.0 33.0 35.0 26.5 35.0 100 31.58625 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 2.0 11 2.0 12 4.0 13 4.0 14 9.0 15 7.0 16 8.0 17 6.0 18 5.0 19 10.0 20 11.0 21 12.0 22 8.0 23 11.0 24 12.0 25 16.0 26 19.0 27 17.0 28 22.0 29 38.0 30 50.0 31 45.0 32 68.0 33 92.0 34 103.0 35 198.0 36 324.0 37 899.0 38 1663.0 39 332.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.525 14.774999999999999 10.925 47.775 2 18.099999999999998 22.95 39.6 19.35 3 20.974999999999998 27.200000000000003 26.85 24.975 4 23.875 33.175 20.45 22.5 5 23.625 36.075 22.900000000000002 17.4 6 19.375 36.65 25.4 18.575 7 16.8 17.625 44.275 21.3 8 18.125 24.5 31.825 25.55 9 19.3 22.6 32.875 25.224999999999998 10-11 22.625 32.824999999999996 23.150000000000002 21.4 12-13 20.225 27.4125 29.212500000000002 23.150000000000002 14-15 20.790098762345295 27.51593949243655 29.128641080135015 22.565320665083135 16-17 22.3 27.325 28.175 22.2 18-19 21.512500000000003 28.449999999999996 27.3 22.7375 20-21 21.975 28.475 27.2625 22.287499999999998 22-23 21.762500000000003 27.8625 28.237499999999997 22.1375 24-25 21.3125 28.4375 27.750000000000004 22.5 26-27 21.55 28.8625 28.462500000000002 21.125 28-29 21.6875 28.1625 28.000000000000004 22.15 30-31 21.75 27.224999999999998 27.987499999999997 23.0375 32-33 20.9875 30.4 27.212500000000002 21.4 34-35 22.112499999999997 28.000000000000004 28.125 21.762500000000003 36-37 22.1 27.725 28.237499999999997 21.9375 38-39 21.5375 28.075 27.2625 23.125 40-41 21.224999999999998 28.299999999999997 28.1625 22.3125 42-43 21.45 28.725 27.975 21.85 44-45 21.8875 27.224999999999998 28.025 22.8625 46-47 21.212500000000002 28.6125 27.725 22.45 48-49 21.45 28.1625 27.675 22.7125 50-51 21.99574840565212 27.897961735650867 27.810428910841566 22.295860947855445 52-53 21.383018631986992 27.935475803426286 27.335250719019633 23.34625484556709 54-55 22.525000000000002 27.5875 28.462500000000002 21.425 56-57 20.8 29.0875 28.875 21.2375 58-59 21.15 29.0875 27.962500000000002 21.8 60-61 22.425 27.9125 27.725 21.9375 62-63 21.8625 28.599999999999998 28.1 21.4375 64-65 21.6875 28.5625 27.35 22.400000000000002 66-67 21.1625 27.950000000000003 28.1125 22.775000000000002 68-69 23.0625 28.6875 27.700000000000003 20.549999999999997 70-71 21.575 28.525 28.15 21.75 72-73 21.9625 27.500000000000004 28.0625 22.475 74-75 21.45 27.987499999999997 28.812500000000004 21.75 76-77 22.4625 27.650000000000002 29.2375 20.65 78-79 22.3875 27.5875 27.6875 22.3375 80-81 21.8625 28.65 28.000000000000004 21.4875 82-83 21.85 28.349999999999998 27.962500000000002 21.837500000000002 84-85 21.712500000000002 27.700000000000003 28.375 22.2125 86-87 21.715214401800225 29.341167645955746 27.953494186773348 20.990123765470685 88-89 22.88072018004501 28.51962990747687 27.74443610902726 20.855213803450862 90-91 22.73068267066767 28.532133033258315 27.28182045511378 21.45536384096024 92-93 21.837500000000002 28.275 28.4125 21.475 94-95 22.5125 28.3625 27.525 21.6 96-97 21.85 27.950000000000003 28.462500000000002 21.7375 98-99 21.965245655706962 28.103512939117394 27.84098012251531 22.090261282660332 100 21.2 28.199999999999996 28.925 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 2.0 24 0.0 25 1.0 26 4.0 27 8.5 28 11.0 29 15.0 30 23.0 31 24.5 32 31.5 33 45.5 34 56.5 35 72.0 36 99.0 37 116.5 38 131.5 39 160.0 40 190.5 41 230.5 42 260.0 43 281.0 44 282.5 45 276.5 46 254.5 47 224.5 48 226.0 49 200.0 50 156.5 51 138.0 52 114.0 53 89.0 54 72.0 55 49.5 56 35.0 57 25.0 58 18.5 59 16.0 60 11.0 61 10.0 62 9.0 63 3.5 64 2.5 65 4.5 66 4.0 67 2.5 68 2.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.5 74 1.0 75 1.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0375 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.025 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88 0.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509644 spots for SRR3207854.sra Written 1509644 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra Read 1509625 spots for SRR3207854.sra Written 1509625 spots for SRR3207854.sra SRR ids: ['SRR3207854.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wng1v1h3 SRR3207854.sra spots: 30192519 blocks: [[1, 1509625], [1509626, 3019250], [3019251, 4528875], [4528876, 6038500], [6038501, 7548125], [7548126, 9057750], [9057751, 10567375], [10567376, 12077000], [12077001, 13586625], [13586626, 15096250], [15096251, 16605875], [16605876, 18115500], [18115501, 19625125], [19625126, 21134750], [21134751, 22644375], [22644376, 24154000], [24154001, 25663625], [25663626, 27173250], [27173251, 28682875], [28682876, 30192519]] SRR3207854 file size 7846644 SRR3207854 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207854 SRR3207854_1.fastq Input file: SRR3207854_1.fastq trimmed: SRR3207854-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 08:47:35 2025 >> started Tue Feb 11 08:47:48 2025 >> done (13.472s) 30192519 reads processed; of these: 7326 ( 0.02%) short reads filtered out after trimming by size control 21407 ( 0.07%) empty reads filtered out after trimming by size control 30163786 (99.90%) reads available; of these: 2744952 ( 9.10%) trimmed reads available after processing 27418834 (90.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1134 0.00% 19 1363 0.00% 20 1607 0.01% 21 2101 0.01% 22 2782 0.01% 23 3658 0.01% 24 4544 0.02% 25 6168 0.02% 26 5814 0.02% 27 5718 0.02% 28 5794 0.02% 29 5758 0.02% 30 5886 0.02% 31 5819 0.02% 32 5856 0.02% 33 6214 0.02% 34 6556 0.02% 35 7097 0.02% 36 7240 0.02% 37 7828 0.03% 38 8174 0.03% 39 8582 0.03% 40 9119 0.03% 41 9240 0.03% 42 10087 0.03% 43 10603 0.04% 44 11473 0.04% 45 11849 0.04% 46 12259 0.04% 47 13045 0.04% 48 13720 0.05% 49 14795 0.05% 50 15629 0.05% 51 16161 0.05% 52 16666 0.06% 53 17740 0.06% 54 18960 0.06% 55 19735 0.07% 56 20676 0.07% 57 21363 0.07% 58 22203 0.07% 59 21835 0.07% 60 22568 0.07% 61 22407 0.07% 62 22722 0.08% 63 23048 0.08% 64 23047 0.08% 65 23910 0.08% 66 23922 0.08% 67 25186 0.08% 68 25780 0.09% 69 24797 0.08% 70 25537 0.08% 71 26501 0.09% 72 27498 0.09% 73 28101 0.09% 74 28428 0.09% 75 28105 0.09% 76 20689 0.07% 77 23771 0.08% 78 27034 0.09% 79 30037 0.10% 80 32697 0.11% 81 34756 0.12% 82 38103 0.13% 83 40740 0.14% 84 42201 0.14% 85 45942 0.15% 86 49928 0.17% 87 53349 0.18% 88 56697 0.19% 89 60402 0.20% 90 69012 0.23% 91 78651 0.26% 92 87098 0.29% 93 99438 0.33% 94 115877 0.38% 95 136691 0.45% 96 160018 0.53% 97 188508 0.62% 98 213336 0.71% 99 215569 0.71% 100 27418834 90.90% 30163786 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=48.60 fanout-score-rank=5 prefix-density=0.65 prefix-fanout=33.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=276.36 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=29.8 sequence=TTCTTCTTCTTT Started job on | Feb 11 08:48:04 Started mapping on | Feb 11 08:48:04 Finished on | Feb 11 08:48:35 Mapping speed, Million of reads per hour | 3502.89 Number of input reads | 30163786 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 28896542 Uniquely mapped reads % | 95.80% Average mapped length | 97.89 Number of splices: Total | 8401573 Number of splices: Annotated (sjdb) | 8233922 Number of splices: GT/AG | 8272633 Number of splices: GC/AG | 104195 Number of splices: AT/AC | 8269 Number of splices: Non-canonical | 16476 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 1.95 Insertion rate per base | 0.01% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 675195 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 101118 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.62% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 592049 592049 592049 N_multimapping 675195 675195 675195 N_noFeature 1337227 14981039 15048641 N_ambiguous 303851 49569 50635 UnstrandedReadsAssigned:27255464 PositiveStrandReadsAssigned:13865934 NegativeStrandReadsAssigned:13797266 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207854 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207854-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,163,786 reads, 27,923,145 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR3207854.ke.tsv 34699 SRR3207854.se.tsv 87100 total ==> SRR3207854.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 992.497 27.281 Potri.005G024800.1.v4.1 1035 936 219 12.3417 Potri.004G059700.1.v4.1 961 862 39 2.38651 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 548.894 10.1804 Potri.016G087400.1.v4.1 270 171 1076.47 332.055 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 102.52 3.23043 Potri.012G127500.1.v4.1 977 878 3263 196.033 ==> SRR3207854.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1729 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 493 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207854 completed mapping pipeline successfully