Starting /dee2/code/volunteer_pipeline.sh SRR3207855 current disk space = 3055783100416 free memory = 1404635704 SRR3207855 SRAfilesize db27f2d5d1f4daf6e8f8b24f1196ee1a SRR3207855.sra SRR3207855.sra file validated SRR3207855 is single end SRR3207855 is conventional basespace SRR3207855 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207855_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.929 34.0 31.0 34.0 31.0 34.0 2 33.045 34.0 33.0 34.0 31.0 34.0 3 33.19025 34.0 34.0 34.0 31.0 34.0 4 36.5245 37.0 37.0 37.0 35.0 37.0 5 36.4325 37.0 37.0 37.0 35.0 37.0 6 36.41725 37.0 37.0 37.0 35.0 37.0 7 36.416 37.0 37.0 37.0 35.0 37.0 8 36.426 37.0 37.0 37.0 35.0 37.0 9 38.184 39.0 39.0 39.0 37.0 39.0 10-11 38.077749999999995 39.0 38.5 39.0 36.0 39.0 12-13 38.109875 39.0 39.0 39.0 36.0 39.0 14-15 39.603375 41.0 40.0 41.0 37.0 41.0 16-17 39.687375 41.0 40.0 41.0 37.0 41.0 18-19 39.59175 41.0 40.0 41.0 37.0 41.0 20-21 39.60275 41.0 40.0 41.0 37.0 41.0 22-23 39.598125 41.0 40.0 41.0 37.0 41.0 24-25 39.53875 41.0 40.0 41.0 37.0 41.0 26-27 39.285 41.0 39.5 41.0 36.5 41.0 28-29 39.163375 41.0 39.0 41.0 36.0 41.0 30-31 38.665125 40.0 38.5 41.0 34.5 41.0 32-33 38.81575 40.5 38.5 41.0 35.0 41.0 34-35 39.110875 41.0 39.0 41.0 36.0 41.0 36-37 39.22275 41.0 39.0 41.0 36.0 41.0 38-39 38.727000000000004 40.5 38.5 41.0 34.5 41.0 40-41 38.801875 40.0 39.0 41.0 35.0 41.0 42-43 38.646249999999995 40.0 38.5 41.0 34.5 41.0 44-45 38.71775 40.0 38.0 41.0 35.0 41.0 46-47 38.682249999999996 40.0 38.5 41.0 34.5 41.0 48-49 38.724875 40.0 38.5 41.0 35.0 41.0 50-51 38.6545 40.0 38.5 41.0 35.0 41.0 52-53 38.498875 40.0 38.0 41.0 34.0 41.0 54-55 37.973124999999996 40.0 38.0 41.0 33.5 41.0 56-57 38.029875000000004 40.0 38.0 41.0 34.0 41.0 58-59 37.81175 40.0 37.0 41.0 33.5 41.0 60-61 37.49625 39.5 37.0 41.0 33.0 41.0 62-63 37.306749999999994 39.0 36.5 41.0 32.5 41.0 64-65 37.033 39.0 36.0 40.5 32.5 41.0 66-67 36.361625000000004 38.5 35.5 40.0 31.0 41.0 68-69 35.99425 37.5 35.0 40.0 31.0 41.0 70-71 35.578625 37.0 35.0 39.0 30.5 41.0 72-73 35.279624999999996 36.5 35.0 39.0 30.5 40.5 74-75 34.783249999999995 36.0 34.0 38.5 30.0 40.0 76-77 33.811875 35.0 33.5 37.0 29.0 39.0 78-79 33.965 35.0 34.0 37.0 29.5 39.0 80-81 33.44425 35.0 34.0 36.5 29.0 38.0 82-83 33.071625 35.0 34.0 36.0 29.0 37.0 84-85 32.89475 35.0 34.0 36.0 28.5 37.0 86-87 32.824375 35.0 34.0 35.0 29.0 36.5 88-89 32.232749999999996 35.0 33.0 35.0 27.5 36.0 90-91 32.179874999999996 35.0 33.0 35.0 27.5 36.0 92-93 32.024 35.0 33.0 35.0 27.0 36.0 94-95 31.838124999999998 35.0 33.0 35.0 26.5 35.0 96-97 30.88975 34.0 32.0 35.0 22.0 35.0 98-99 31.117375 34.0 32.5 35.0 24.0 35.0 100 31.1355 34.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 2.0 10 1.0 11 5.0 12 5.0 13 3.0 14 5.0 15 3.0 16 4.0 17 9.0 18 6.0 19 9.0 20 8.0 21 9.0 22 10.0 23 17.0 24 19.0 25 15.0 26 20.0 27 31.0 28 45.0 29 42.0 30 49.0 31 59.0 32 62.0 33 81.0 34 132.0 35 201.0 36 350.0 37 903.0 38 1592.0 39 301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.474999999999998 15.1 13.200000000000001 44.224999999999994 2 18.175 25.275 37.824999999999996 18.725 3 20.80520130032508 28.432108027006752 26.056514128532132 24.706176544136035 4 23.925 35.075 19.775000000000002 21.224999999999998 5 23.75 36.199999999999996 22.05 18.0 6 19.35 36.95 25.15 18.55 7 17.424999999999997 19.025 42.775 20.775 8 18.35 22.425 31.3 27.925 9 21.075 22.475 32.1 24.349999999999998 10-11 22.8125 33.287499999999994 23.1875 20.7125 12-13 20.724999999999998 26.650000000000002 29.299999999999997 23.325000000000003 14-15 21.999749718433236 27.005381053685397 28.50707045426104 22.487798773620323 16-17 21.425 28.4 27.787499999999998 22.3875 18-19 21.175 29.049999999999997 27.425 22.35 20-21 21.2375 28.0875 28.225 22.45 22-23 21.212500000000002 29.025000000000002 28.0875 21.675 24-25 22.0125 28.575 27.187499999999996 22.225 26-27 21.925 28.675 27.55 21.85 28-29 20.825 28.7375 27.800000000000004 22.6375 30-31 22.05 27.3875 28.4375 22.125 32-33 21.25 28.849999999999998 27.425 22.475 34-35 22.625 28.287499999999998 27.625 21.462500000000002 36-37 21.05 28.1875 28.349999999999998 22.412499999999998 38-39 21.762500000000003 28.0625 28.7 21.475 40-41 21.85 28.5875 27.800000000000004 21.762500000000003 42-43 22.05 28.225 28.012500000000003 21.712500000000002 44-45 21.8875 27.875 28.799999999999997 21.4375 46-47 21.9625 28.875 27.2625 21.9 48-49 21.45 28.237499999999997 28.15 22.162499999999998 50-51 21.70377783337503 28.083562672004003 27.858393795346508 22.354265699274457 52-53 21.22122122122122 28.72872872872873 28.741241241241237 21.30880880880881 54-55 22.2625 27.474999999999998 28.462500000000002 21.8 56-57 22.525000000000002 28.050000000000004 27.500000000000004 21.925 58-59 22.05 28.9125 27.237499999999997 21.8 60-61 21.6875 28.249999999999996 27.85 22.2125 62-63 21.987499999999997 29.037499999999998 27.425 21.55 64-65 21.925 28.249999999999996 27.9375 21.8875 66-67 21.637500000000003 27.474999999999998 29.025000000000002 21.8625 68-69 22.6 28.787499999999998 27.737499999999997 20.875 70-71 21.2875 28.499999999999996 27.8875 22.325 72-73 22.287499999999998 28.599999999999998 28.5875 20.525 74-75 21.7375 27.6625 28.537499999999998 22.0625 76-77 21.462500000000002 28.212500000000002 28.1625 22.162499999999998 78-79 21.5375 27.875 28.025 22.5625 80-81 21.45 28.349999999999998 27.787499999999998 22.412499999999998 82-83 22.912499999999998 27.462500000000002 28.199999999999996 21.425 84-85 22.3375 27.9375 27.9125 21.8125 86-87 22.35 27.750000000000004 28.5875 21.3125 88-89 23.0278784848106 27.703462932866607 28.328541067633456 20.940117514689334 90-91 21.042760690172543 27.60690172543136 29.56989247311828 21.780445111277817 92-93 21.6 27.975 28.512500000000003 21.912499999999998 94-95 23.3625 27.725 27.737499999999997 21.175 96-97 21.3125 29.5375 28.1625 20.9875 98-99 23.1875 27.575 27.5125 21.725 100 23.375 27.85 26.85 21.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 2.0 25 3.5 26 6.0 27 9.5 28 13.0 29 17.5 30 22.5 31 29.0 32 33.0 33 43.0 34 58.5 35 73.0 36 99.5 37 122.0 38 138.5 39 160.0 40 195.5 41 224.5 42 249.0 43 258.5 44 261.5 45 280.0 46 267.0 47 240.0 48 218.5 49 202.5 50 173.0 51 134.5 52 107.5 53 85.0 54 62.5 55 41.5 56 35.5 57 26.5 58 14.0 59 15.0 60 15.0 61 10.5 62 7.0 63 5.0 64 7.5 65 6.5 66 4.5 67 3.5 68 2.5 69 2.5 70 1.5 71 1.0 72 0.5 73 1.5 74 3.0 75 1.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.11249999999999999 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.075 52-53 0.1 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8747808665164 99.7 2 0.10017530678687703 0.2 3 0.0 0.0 4 0.025043826696719257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88 0.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716776 spots for SRR3207855.sra Written 2716776 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra Read 2716767 spots for SRR3207855.sra Written 2716767 spots for SRR3207855.sra SRR ids: ['SRR3207855.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uxlfy6s_ SRR3207855.sra spots: 54335349 blocks: [[1, 2716767], [2716768, 5433534], [5433535, 8150301], [8150302, 10867068], [10867069, 13583835], [13583836, 16300602], [16300603, 19017369], [19017370, 21734136], [21734137, 24450903], [24450904, 27167670], [27167671, 29884437], [29884438, 32601204], [32601205, 35317971], [35317972, 38034738], [38034739, 40751505], [40751506, 43468272], [43468273, 46185039], [46185040, 48901806], [48901807, 51618573], [51618574, 54335349]] SRR3207855 file size 14129710 SRR3207855 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207855 SRR3207855_1.fastq Input file: SRR3207855_1.fastq trimmed: SRR3207855-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 08:48:32 2025 >> started Tue Feb 11 08:49:02 2025 >> done (29.442s) 54335349 reads processed; of these: 10200 ( 0.02%) short reads filtered out after trimming by size control 61080 ( 0.11%) empty reads filtered out after trimming by size control 54264069 (99.87%) reads available; of these: 5386504 ( 9.93%) trimmed reads available after processing 48877565 (90.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1693 0.00% 19 2173 0.00% 20 2676 0.00% 21 3441 0.01% 22 4697 0.01% 23 6257 0.01% 24 7865 0.01% 25 10668 0.02% 26 10421 0.02% 27 10193 0.02% 28 10693 0.02% 29 10375 0.02% 30 10445 0.02% 31 10684 0.02% 32 10706 0.02% 33 11345 0.02% 34 12264 0.02% 35 12980 0.02% 36 13751 0.03% 37 14366 0.03% 38 15451 0.03% 39 15855 0.03% 40 17026 0.03% 41 17706 0.03% 42 19074 0.04% 43 20006 0.04% 44 21495 0.04% 45 22017 0.04% 46 23018 0.04% 47 24649 0.05% 48 26198 0.05% 49 28068 0.05% 50 29826 0.05% 51 30362 0.06% 52 31738 0.06% 53 33433 0.06% 54 36370 0.07% 55 38258 0.07% 56 39740 0.07% 57 40783 0.08% 58 43515 0.08% 59 42596 0.08% 60 43693 0.08% 61 44006 0.08% 62 44554 0.08% 63 44210 0.08% 64 44620 0.08% 65 46483 0.09% 66 46279 0.09% 67 48383 0.09% 68 49388 0.09% 69 49190 0.09% 70 51020 0.09% 71 52528 0.10% 72 53775 0.10% 73 55250 0.10% 74 55467 0.10% 75 54938 0.10% 76 40980 0.08% 77 46999 0.09% 78 53351 0.10% 79 59353 0.11% 80 64769 0.12% 81 69615 0.13% 82 75396 0.14% 83 80749 0.15% 84 83689 0.15% 85 91257 0.17% 86 99259 0.18% 87 105242 0.19% 88 113525 0.21% 89 120659 0.22% 90 136711 0.25% 91 154991 0.29% 92 172077 0.32% 93 197353 0.36% 94 231198 0.43% 95 271222 0.50% 96 317776 0.59% 97 374555 0.69% 98 422841 0.78% 99 424276 0.78% 100 48877565 90.07% 54264069 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=46.95 fanout-score-rank=5 prefix-density=0.46 prefix-fanout=33.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=217.51 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=24.9 sequence=AAGAAGAAGAAA Started job on | Feb 11 08:49:23 Started mapping on | Feb 11 08:49:23 Finished on | Feb 11 08:50:23 Mapping speed, Million of reads per hour | 3255.84 Number of input reads | 54264069 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 50850070 Uniquely mapped reads % | 93.71% Average mapped length | 97.86 Number of splices: Total | 14092312 Number of splices: Annotated (sjdb) | 13801500 Number of splices: GT/AG | 13874711 Number of splices: GC/AG | 175225 Number of splices: AT/AC | 14029 Number of splices: Non-canonical | 28347 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1234332 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 444133 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2179667 2179667 2179667 N_multimapping 1234332 1234332 1234332 N_noFeature 2415804 26356744 26527232 N_ambiguous 561492 90150 90258 UnstrandedReadsAssigned:47872774 PositiveStrandReadsAssigned:24403176 NegativeStrandReadsAssigned:24232580 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207855 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207855-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 54,264,069 reads, 49,311,805 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,328 rounds 52401 SRR3207855.ke.tsv 34699 SRR3207855.se.tsv 87100 total ==> SRR3207855.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1783 27.2857 Potri.005G024800.1.v4.1 1035 936 426 13.3657 Potri.004G059700.1.v4.1 961 862 40 1.36273 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 914.613 9.44421 Potri.016G087400.1.v4.1 270 171 1863.47 320.026 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 139 2.43847 Potri.012G127500.1.v4.1 977 878 5707 190.885 ==> SRR3207855.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3117 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 871 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 53 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207855 completed mapping pipeline successfully