Starting /dee2/code/volunteer_pipeline.sh SRR3207856 current disk space = 3054913818624 free memory = 1511893744 SRR3207856 SRAfilesize ccc194cb90e7a604e73615b934fab97e SRR3207856.sra SRR3207856.sra file validated SRR3207856 is single end SRR3207856 is conventional basespace SRR3207856 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207856_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2655 34.0 31.0 34.0 31.0 34.0 2 32.67675 34.0 31.0 34.0 31.0 34.0 3 33.05325 34.0 33.0 34.0 31.0 34.0 4 36.40525 37.0 37.0 37.0 35.0 37.0 5 36.38825 37.0 37.0 37.0 35.0 37.0 6 36.3265 37.0 37.0 37.0 35.0 37.0 7 36.3545 37.0 37.0 37.0 35.0 37.0 8 36.3715 37.0 37.0 37.0 35.0 37.0 9 38.263 39.0 39.0 39.0 37.0 39.0 10-11 38.208875 39.0 39.0 39.0 37.0 39.0 12-13 38.228375 39.0 39.0 39.0 37.0 39.0 14-15 39.704750000000004 41.0 40.0 41.0 37.0 41.0 16-17 39.680625 41.0 40.0 41.0 37.0 41.0 18-19 39.74575 41.0 40.0 41.0 37.5 41.0 20-21 39.659499999999994 41.0 40.0 41.0 37.0 41.0 22-23 39.546375 41.0 40.0 41.0 37.0 41.0 24-25 39.578 41.0 40.0 41.0 37.0 41.0 26-27 39.4465 41.0 39.5 41.0 36.5 41.0 28-29 39.367 41.0 39.0 41.0 37.0 41.0 30-31 39.236625 41.0 39.0 41.0 36.0 41.0 32-33 39.058 40.0 39.0 41.0 36.0 41.0 34-35 39.01775 40.0 39.0 41.0 36.0 41.0 36-37 38.829750000000004 40.0 38.0 41.0 35.0 41.0 38-39 38.715625 40.0 38.0 41.0 35.0 41.0 40-41 38.744 40.0 38.0 41.0 35.0 41.0 42-43 38.795 40.0 38.0 41.0 35.0 41.0 44-45 38.796375 40.0 38.0 41.0 35.0 41.0 46-47 38.606125000000006 40.0 38.0 41.0 34.5 41.0 48-49 38.415875 40.0 38.0 41.0 34.0 41.0 50-51 38.43275 40.0 38.0 41.0 34.0 41.0 52-53 38.5965 40.0 38.0 41.0 34.5 41.0 54-55 38.556875 40.0 38.0 41.0 34.5 41.0 56-57 38.42975 40.0 38.0 41.0 34.0 41.0 58-59 38.129999999999995 40.0 38.0 41.0 34.0 41.0 60-61 37.5745 40.0 37.0 41.0 33.5 41.0 62-63 37.096374999999995 40.0 36.5 41.0 32.0 41.0 64-65 36.9995 39.0 36.0 41.0 32.0 41.0 66-67 36.929500000000004 39.0 35.5 41.0 32.0 41.0 68-69 36.644125 38.0 35.0 40.0 31.5 41.0 70-71 36.36125 37.0 35.0 39.5 32.0 41.0 72-73 35.48625 37.0 35.0 39.0 30.5 41.0 74-75 35.327749999999995 36.0 35.0 39.0 31.0 40.0 76-77 33.796375 35.0 33.0 37.0 29.0 39.0 78-79 34.262125 35.0 34.0 37.0 30.0 39.0 80-81 34.195875 35.0 34.0 37.0 30.5 38.5 82-83 33.9865 35.0 34.0 36.0 31.0 37.0 84-85 33.679 35.0 34.0 36.0 30.5 37.0 86-87 33.456875 35.0 34.0 35.5 30.0 36.5 88-89 33.104625 35.0 34.0 35.0 29.5 36.0 90-91 32.840625 35.0 34.0 35.0 29.0 36.0 92-93 32.5665 35.0 34.0 35.0 29.0 36.0 94-95 32.381249999999994 35.0 33.0 35.0 29.0 35.0 96-97 32.143875 35.0 33.0 35.0 27.0 35.0 98-99 31.9585 35.0 33.0 35.0 27.0 35.0 100 31.95025 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 1.0 10 1.0 11 3.0 12 3.0 13 2.0 14 4.0 15 2.0 16 2.0 17 4.0 18 5.0 19 5.0 20 4.0 21 8.0 22 13.0 23 12.0 24 8.0 25 13.0 26 19.0 27 20.0 28 25.0 29 39.0 30 28.0 31 80.0 32 74.0 33 97.0 34 147.0 35 212.0 36 350.0 37 866.0 38 1574.0 39 375.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.181353767560665 14.840357598978288 15.32567049808429 43.652618135376756 2 18.75 24.4 37.325 19.525000000000002 3 21.65 28.525 27.250000000000004 22.575 4 24.006001500375092 33.10827706926732 20.455113778444613 22.43060765191298 5 23.5 36.3 21.625 18.575 6 17.525 39.15 24.099999999999998 19.225 7 16.875 18.725 42.449999999999996 21.95 8 18.65 23.775 29.525000000000002 28.050000000000004 9 20.150000000000002 22.175 32.574999999999996 25.1 10-11 22.05 33.9625 22.900000000000002 21.087500000000002 12-13 19.5625 27.625 29.5875 23.225 14-15 20.724999999999998 28.237499999999997 29.325000000000003 21.712500000000002 16-17 22.5 27.725 27.3375 22.4375 18-19 21.375 28.1 28.287499999999998 22.237499999999997 20-21 21.9375 28.199999999999996 27.1125 22.75 22-23 22.1375 28.3375 28.050000000000004 21.475 24-25 21.825 28.775000000000002 27.487499999999997 21.912499999999998 26-27 21.7875 28.237499999999997 27.875 22.1 28-29 21.512500000000003 28.375 28.0625 22.05 30-31 21.475 27.712500000000002 28.4375 22.375 32-33 22.825 28.212500000000002 27.5875 21.375 34-35 21.5 28.3375 27.625 22.537499999999998 36-37 21.55 28.212500000000002 27.875 22.3625 38-39 21.65 28.787499999999998 27.900000000000002 21.6625 40-41 23.2875 27.3875 27.875 21.45 42-43 22.1375 27.750000000000004 28.512500000000003 21.6 44-45 21.425 28.875 27.200000000000003 22.5 46-47 21.8 27.725 28.050000000000004 22.425 48-49 21.48491298359835 28.709152372605484 27.72004507324402 22.085889570552148 50-51 21.91334835962935 28.261958427247684 27.598297019784624 22.226396193338342 52-53 21.587500000000002 28.449999999999996 26.974999999999998 22.9875 54-55 21.0375 28.9 28.499999999999996 21.5625 56-57 21.349999999999998 27.575 28.9375 22.1375 58-59 21.905598794878234 27.516947024855636 27.981421039417526 22.596033140848608 60-61 21.598984771573605 28.921319796954315 27.66497461928934 21.814720812182742 62-63 21.786214804433683 28.080010192381195 28.02904828640591 22.104726716779208 64-65 22.072355981343755 27.946552376150258 27.71965208622211 22.261439556283875 66-67 21.512500000000003 29.0875 27.487499999999997 21.912499999999998 68-69 21.8 28.1 28.1 22.0 70-71 22.25 27.775 27.675 22.3 72-73 22.400000000000002 27.1375 28.262500000000003 22.2 74-75 22.7625 27.200000000000003 28.0625 21.975 76-77 21.5742710549368 28.869978726066826 27.606056813915654 21.949693405080716 78-79 21.5625 27.375 27.925 23.1375 80-81 21.65 28.9 27.287499999999998 22.162499999999998 82-83 21.8125 28.1125 28.475 21.6 84-85 20.95 28.3625 27.962500000000002 22.725 86-87 21.925 28.3375 28.212500000000002 21.525 88-89 22.075 27.35 28.6875 21.8875 90-91 21.275 27.975 28.6125 22.1375 92-93 22.75 27.5125 27.5875 22.15 94-95 22.7125 28.3125 27.737499999999997 21.2375 96-97 22.5625 28.3125 27.787499999999998 21.337500000000002 98-99 21.4 28.5625 28.212500000000002 21.825 100 22.025 28.725 27.025 22.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 1.0 24 1.0 25 0.0 26 2.5 27 5.0 28 8.0 29 10.5 30 17.0 31 31.0 32 39.0 33 44.5 34 61.0 35 80.5 36 90.0 37 94.0 38 126.5 39 179.0 40 204.5 41 233.5 42 264.0 43 275.0 44 278.5 45 265.5 46 255.5 47 248.0 48 229.5 49 202.0 50 161.0 51 129.5 52 115.5 53 91.0 54 59.0 55 38.5 56 34.0 57 28.5 58 19.0 59 13.0 60 7.0 61 7.0 62 7.0 63 6.0 64 6.0 65 5.5 66 5.0 67 3.5 68 2.0 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 1.0 75 2.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.1625 50-51 0.17500000000000002 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.42500000000000004 60-61 1.5 62-63 1.8875 64-65 0.8375 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.11249999999999999 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373461 spots for SRR3207856.sra Written 1373461 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra Read 1373442 spots for SRR3207856.sra Written 1373442 spots for SRR3207856.sra SRR ids: ['SRR3207856.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rv9ikun1 SRR3207856.sra spots: 27468859 blocks: [[1, 1373442], [1373443, 2746884], [2746885, 4120326], [4120327, 5493768], [5493769, 6867210], [6867211, 8240652], [8240653, 9614094], [9614095, 10987536], [10987537, 12360978], [12360979, 13734420], [13734421, 15107862], [15107863, 16481304], [16481305, 17854746], [17854747, 19228188], [19228189, 20601630], [20601631, 21975072], [21975073, 23348514], [23348515, 24721956], [24721957, 26095398], [26095399, 27468859]] SRR3207856 file size 7152144 SRR3207856 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207856 SRR3207856_1.fastq Input file: SRR3207856_1.fastq trimmed: SRR3207856-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:29:37 2025 >> started Tue Feb 11 09:29:52 2025 >> done (14.444s) 27468859 reads processed; of these: 3377 ( 0.01%) short reads filtered out after trimming by size control 6575 ( 0.02%) empty reads filtered out after trimming by size control 27458907 (99.96%) reads available; of these: 1626727 ( 5.92%) trimmed reads available after processing 25832180 (94.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 576 0.00% 19 884 0.00% 20 1063 0.00% 21 1351 0.00% 22 1837 0.01% 23 2622 0.01% 24 3476 0.01% 25 4355 0.02% 26 4660 0.02% 27 4500 0.02% 28 4554 0.02% 29 4628 0.02% 30 4631 0.02% 31 4924 0.02% 32 5139 0.02% 33 5084 0.02% 34 5443 0.02% 35 5716 0.02% 36 5893 0.02% 37 6041 0.02% 38 6041 0.02% 39 6157 0.02% 40 6462 0.02% 41 6543 0.02% 42 6754 0.02% 43 6963 0.03% 44 7122 0.03% 45 7696 0.03% 46 8201 0.03% 47 8065 0.03% 48 7846 0.03% 49 8333 0.03% 50 8083 0.03% 51 8155 0.03% 52 8611 0.03% 53 8882 0.03% 54 9301 0.03% 55 9513 0.03% 56 9751 0.04% 57 10185 0.04% 58 10628 0.04% 59 11083 0.04% 60 11055 0.04% 61 11646 0.04% 62 11784 0.04% 63 11841 0.04% 64 12061 0.04% 65 12379 0.05% 66 13434 0.05% 67 13481 0.05% 68 13891 0.05% 69 14424 0.05% 70 15233 0.06% 71 16085 0.06% 72 16823 0.06% 73 17537 0.06% 74 18158 0.07% 75 19224 0.07% 76 10992 0.04% 77 12729 0.05% 78 14979 0.05% 79 16948 0.06% 80 17771 0.06% 81 19456 0.07% 82 20434 0.07% 83 22404 0.08% 84 23432 0.09% 85 24809 0.09% 86 26431 0.10% 87 28582 0.10% 88 31708 0.12% 89 34411 0.13% 90 38140 0.14% 91 42783 0.16% 92 48938 0.18% 93 56352 0.21% 94 67060 0.24% 95 80011 0.29% 96 98199 0.36% 97 117564 0.43% 98 138443 0.50% 99 147343 0.54% 100 25832180 94.08% 27458907 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=74.41 fanout-score-rank=11 prefix-density=0.52 prefix-fanout=37.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=322.94 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=15.7 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGAAACTTGCACAATGCACCTACGAGCAAGACCATTTGCTACGATGCTCTTGGCAGCTT Started job on | Feb 11 09:30:10 Started mapping on | Feb 11 09:30:10 Finished on | Feb 11 09:30:39 Mapping speed, Million of reads per hour | 3408.69 Number of input reads | 27458907 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 26057478 Uniquely mapped reads % | 94.90% Average mapped length | 98.56 Number of splices: Total | 7364501 Number of splices: Annotated (sjdb) | 7221446 Number of splices: GT/AG | 7246489 Number of splices: GC/AG | 96657 Number of splices: AT/AC | 7760 Number of splices: Non-canonical | 13595 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 669984 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 294440 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 731445 731445 731445 N_multimapping 669984 669984 669984 N_noFeature 1235055 13499930 13608669 N_ambiguous 276238 46538 46275 UnstrandedReadsAssigned:24546185 PositiveStrandReadsAssigned:12511010 NegativeStrandReadsAssigned:12402534 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207856 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207856-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,458,907 reads, 25,324,635 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR3207856.ke.tsv 34699 SRR3207856.se.tsv 87100 total ==> SRR3207856.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 889 26.7582 Potri.005G024800.1.v4.1 1035 936 185 11.4163 Potri.004G059700.1.v4.1 961 862 52 3.48439 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 428.279 8.69817 Potri.016G087400.1.v4.1 270 171 1012 341.834 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 118.561 4.09087 Potri.012G127500.1.v4.1 977 878 4990 328.274 ==> SRR3207856.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3085 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 532 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 46 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207856 completed mapping pipeline successfully