Starting /dee2/code/volunteer_pipeline.sh SRR3207857 current disk space = 3055153455104 free memory = 1502963860 SRR3207857 SRAfilesize b605ac5419db729ac471697db9b8efda SRR3207857.sra SRR3207857.sra file validated SRR3207857 is single end SRR3207857 is conventional basespace SRR3207857 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207857_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1315 34.0 31.0 34.0 31.0 34.0 2 32.6625 34.0 33.0 34.0 31.0 34.0 3 33.0925 34.0 33.0 34.0 31.0 34.0 4 36.4695 37.0 37.0 37.0 35.0 37.0 5 36.41775 37.0 37.0 37.0 35.0 37.0 6 36.362 37.0 37.0 37.0 35.0 37.0 7 36.3675 37.0 37.0 37.0 35.0 37.0 8 36.41475 37.0 37.0 37.0 35.0 37.0 9 38.31325 39.0 39.0 39.0 37.0 39.0 10-11 38.29925 39.0 39.0 39.0 37.0 39.0 12-13 38.279375 39.0 39.0 39.0 37.0 39.0 14-15 39.813625 41.0 40.0 41.0 37.5 41.0 16-17 39.776125 41.0 40.0 41.0 37.5 41.0 18-19 39.743125 41.0 40.0 41.0 37.0 41.0 20-21 39.710125 41.0 40.0 41.0 37.0 41.0 22-23 39.622749999999996 41.0 40.0 41.0 37.0 41.0 24-25 39.601375000000004 41.0 40.0 41.0 37.0 41.0 26-27 39.443 41.0 39.5 41.0 36.5 41.0 28-29 39.364125 41.0 39.0 41.0 37.0 41.0 30-31 39.23225 41.0 39.0 41.0 36.0 41.0 32-33 39.106375 40.0 39.0 41.0 36.0 41.0 34-35 39.10025 40.0 39.0 41.0 36.0 41.0 36-37 38.948125000000005 40.0 38.5 41.0 35.5 41.0 38-39 38.835 40.0 38.0 41.0 35.0 41.0 40-41 38.749375 40.0 38.5 41.0 35.0 41.0 42-43 38.78875 40.0 38.0 41.0 35.0 41.0 44-45 38.7485 40.0 38.5 41.0 35.0 41.0 46-47 38.5705 40.0 38.0 41.0 35.0 41.0 48-49 38.46575 40.0 38.0 41.0 35.0 41.0 50-51 38.409375 40.0 38.0 41.0 34.0 41.0 52-53 38.584625 40.0 38.0 41.0 34.5 41.0 54-55 38.592124999999996 40.0 38.0 41.0 35.0 41.0 56-57 38.5 40.0 38.0 41.0 34.5 41.0 58-59 38.08225 40.0 37.5 41.0 34.0 41.0 60-61 37.48225 40.0 37.0 41.0 34.0 41.0 62-63 36.917875 39.5 36.5 41.0 32.5 41.0 64-65 36.849375 39.0 36.0 41.0 32.0 41.0 66-67 36.877 39.0 35.5 41.0 32.0 41.0 68-69 36.593374999999995 38.0 35.0 40.0 31.5 41.0 70-71 36.305 37.0 35.0 39.5 32.0 41.0 72-73 35.539500000000004 37.0 35.0 39.0 31.0 41.0 74-75 35.414125 36.0 35.0 39.0 31.0 40.0 76-77 33.832375 35.0 33.0 36.5 29.5 39.0 78-79 34.407250000000005 35.0 34.0 37.0 30.5 39.0 80-81 34.28575 35.0 34.0 37.0 31.0 38.5 82-83 34.018 35.0 34.0 36.0 31.0 37.0 84-85 33.743625 35.0 34.0 36.0 31.0 37.0 86-87 33.56625 35.0 34.0 35.5 31.0 36.5 88-89 33.159625 35.0 34.0 35.0 29.5 36.0 90-91 32.956125 35.0 34.0 35.0 29.0 36.0 92-93 32.759249999999994 35.0 34.0 35.0 29.0 36.0 94-95 32.549875 35.0 34.0 35.0 29.0 35.5 96-97 32.30025 35.0 33.0 35.0 29.0 35.0 98-99 31.979750000000003 35.0 33.0 35.0 26.5 35.0 100 31.9755 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 4.0 10 3.0 11 4.0 12 3.0 13 2.0 14 3.0 15 5.0 16 2.0 17 2.0 18 7.0 19 6.0 20 5.0 21 7.0 22 4.0 23 6.0 24 8.0 25 12.0 26 18.0 27 15.0 28 27.0 29 25.0 30 36.0 31 63.0 32 76.0 33 93.0 34 152.0 35 239.0 36 339.0 37 874.0 38 1590.0 39 367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.471344127473657 15.16319712156258 16.242611153945003 42.12284759701876 2 19.475 23.075000000000003 37.8 19.650000000000002 3 21.7 27.325 26.900000000000002 24.075 4 23.967975981986488 34.17563172379284 20.465349011758818 21.391043282461847 5 23.05 36.825 21.675 18.45 6 17.125 37.724999999999994 24.775 20.375 7 15.528882220555138 18.629657414353588 44.86121530382596 20.980245061265315 8 20.125 22.35 29.575000000000003 27.950000000000003 9 19.075 24.3 31.8 24.825 10-11 22.675 32.725 23.275000000000002 21.325 12-13 20.474999999999998 26.337500000000002 30.15 23.0375 14-15 20.724999999999998 27.787499999999998 29.1875 22.3 16-17 21.912499999999998 28.3125 28.325 21.45 18-19 22.1875 27.700000000000003 27.8625 22.25 20-21 21.712500000000002 28.4125 27.8375 22.037499999999998 22-23 21.925 28.95 26.724999999999998 22.400000000000002 24-25 21.7 28.375 28.212500000000002 21.712500000000002 26-27 22.5625 28.8625 26.650000000000002 21.925 28-29 21.0125 28.6125 27.6875 22.6875 30-31 21.4375 28.475 28.375 21.712500000000002 32-33 21.3625 27.4125 28.000000000000004 23.225 34-35 21.6 28.65 28.0625 21.6875 36-37 22.1375 28.249999999999996 27.150000000000002 22.4625 38-39 20.674999999999997 28.962500000000002 27.775 22.5875 40-41 21.625 28.762500000000003 27.187499999999996 22.425 42-43 22.0625 28.3625 28.275 21.3 44-45 21.6875 27.224999999999998 27.8375 23.25 46-47 20.7375 28.975 28.212500000000002 22.075 48-49 21.323989488174195 29.220372919534476 26.955324740332877 22.500312851958455 50-51 21.09873607808785 28.732323864347393 28.682267550994865 21.48667250656989 52-53 21.6125 27.8625 27.8625 22.662499999999998 54-55 21.337500000000002 27.8875 28.925 21.85 56-57 20.6875 28.6625 28.237499999999997 22.412499999999998 58-59 21.822752985543683 28.12067881835324 28.434946574481458 21.62162162162162 60-61 21.633694958519463 28.793873643905556 27.37715379706445 22.19527760051053 62-63 21.57867760123014 28.344438749359302 28.024090210148643 22.052793439261915 64-65 21.08388074785245 28.410813542193026 28.372915613946436 22.132390096008084 66-67 22.325 27.325 28.212500000000002 22.1375 68-69 21.712500000000002 28.075 28.15 22.0625 70-71 22.0625 27.250000000000004 27.787499999999998 22.900000000000002 72-73 21.2625 28.275 28.6625 21.8 74-75 22.075 28.175 27.950000000000003 21.8 76-77 22.45995995995996 28.165665665665667 27.52752752752753 21.846846846846844 78-79 22.425 28.1625 28.012500000000003 21.4 80-81 21.1375 28.6625 28.725 21.475 82-83 22.0 28.6375 27.200000000000003 22.162499999999998 84-85 21.0625 28.8625 27.462500000000002 22.6125 86-87 22.287499999999998 28.3875 28.037499999999998 21.2875 88-89 22.1 28.65 27.525 21.725 90-91 22.375 28.299999999999997 28.449999999999996 20.875 92-93 22.9625 28.249999999999996 27.2625 21.525 94-95 21.7 28.6125 28.499999999999996 21.1875 96-97 23.075000000000003 28.462500000000002 28.025 20.4375 98-99 21.875 28.7 28.349999999999998 21.075 100 21.675 28.225 27.700000000000003 22.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 4.0 25 3.5 26 4.0 27 8.5 28 12.0 29 16.0 30 19.5 31 28.0 32 44.0 33 49.0 34 53.5 35 71.0 36 89.5 37 123.0 38 146.5 39 168.5 40 206.5 41 229.5 42 255.0 43 280.0 44 296.0 45 274.0 46 254.0 47 240.5 48 208.0 49 176.5 50 138.5 51 114.5 52 107.5 53 95.0 54 65.5 55 46.0 56 36.5 57 31.5 58 25.0 59 15.0 60 10.0 61 7.5 62 6.0 63 6.5 64 5.0 65 3.5 66 5.5 67 4.0 68 1.5 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 1.0 75 0.5 76 0.5 77 1.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.11249999999999999 50-51 0.11249999999999999 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.5625 60-61 2.0625 62-63 2.45 64-65 1.05 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.1 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899413 spots for SRR3207857.sra Written 1899413 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra Read 1899403 spots for SRR3207857.sra Written 1899403 spots for SRR3207857.sra SRR ids: ['SRR3207857.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2yczvdww SRR3207857.sra spots: 37988070 blocks: [[1, 1899403], [1899404, 3798806], [3798807, 5698209], [5698210, 7597612], [7597613, 9497015], [9497016, 11396418], [11396419, 13295821], [13295822, 15195224], [15195225, 17094627], [17094628, 18994030], [18994031, 20893433], [20893434, 22792836], [22792837, 24692239], [24692240, 26591642], [26591643, 28491045], [28491046, 30390448], [30390449, 32289851], [32289852, 34189254], [34189255, 36088657], [36088658, 37988070]] SRR3207857 file size 9895107 SRR3207857 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207857 SRR3207857_1.fastq Input file: SRR3207857_1.fastq trimmed: SRR3207857-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:16:14 2025 >> started Tue Feb 11 09:16:35 2025 >> done (20.192s) 37988070 reads processed; of these: 4507 ( 0.01%) short reads filtered out after trimming by size control 7806 ( 0.02%) empty reads filtered out after trimming by size control 37975757 (99.97%) reads available; of these: 2148164 ( 5.66%) trimmed reads available after processing 35827593 (94.34%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 829 0.00% 19 1093 0.00% 20 1296 0.00% 21 1799 0.00% 22 2506 0.01% 23 3646 0.01% 24 4611 0.01% 25 5935 0.02% 26 6099 0.02% 27 5949 0.02% 28 5935 0.02% 29 6342 0.02% 30 6408 0.02% 31 6585 0.02% 32 6787 0.02% 33 6814 0.02% 34 7148 0.02% 35 7514 0.02% 36 7834 0.02% 37 7917 0.02% 38 8051 0.02% 39 8696 0.02% 40 8728 0.02% 41 8691 0.02% 42 8967 0.02% 43 9394 0.02% 44 9617 0.03% 45 10047 0.03% 46 10813 0.03% 47 10458 0.03% 48 10611 0.03% 49 10840 0.03% 50 10448 0.03% 51 10550 0.03% 52 11178 0.03% 53 11727 0.03% 54 12110 0.03% 55 12559 0.03% 56 12926 0.03% 57 13280 0.03% 58 14114 0.04% 59 14471 0.04% 60 14695 0.04% 61 15088 0.04% 62 15348 0.04% 63 15486 0.04% 64 15531 0.04% 65 16198 0.04% 66 19278 0.05% 67 17683 0.05% 68 18135 0.05% 69 18619 0.05% 70 19872 0.05% 71 21012 0.06% 72 22053 0.06% 73 22915 0.06% 74 23650 0.06% 75 24941 0.07% 76 14408 0.04% 77 16414 0.04% 78 20036 0.05% 79 22045 0.06% 80 23381 0.06% 81 25333 0.07% 82 26633 0.07% 83 28955 0.08% 84 30516 0.08% 85 32335 0.09% 86 34424 0.09% 87 37456 0.10% 88 40629 0.11% 89 44763 0.12% 90 49842 0.13% 91 55434 0.15% 92 64666 0.17% 93 74318 0.20% 94 88445 0.23% 95 106186 0.28% 96 129573 0.34% 97 156364 0.41% 98 185374 0.49% 99 198807 0.52% 100 35827593 94.34% 37975757 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=78.50 fanout-score-rank=10 prefix-density=0.84 prefix-fanout=38.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=285.49 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.3 sequence=TTCTTCTTCTTC Started job on | Feb 11 09:16:50 Started mapping on | Feb 11 09:16:50 Finished on | Feb 11 09:17:29 Mapping speed, Million of reads per hour | 3505.45 Number of input reads | 37975757 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 36392283 Uniquely mapped reads % | 95.83% Average mapped length | 98.56 Number of splices: Total | 10180066 Number of splices: Annotated (sjdb) | 9965610 Number of splices: GT/AG | 10011392 Number of splices: GC/AG | 137010 Number of splices: AT/AC | 11044 Number of splices: Non-canonical | 20620 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 983672 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 379689 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 599802 599802 599802 N_multimapping 983672 983672 983672 N_noFeature 1855802 18906098 19093587 N_ambiguous 384384 68396 68455 UnstrandedReadsAssigned:34152097 PositiveStrandReadsAssigned:17417789 NegativeStrandReadsAssigned:17230241 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207857 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207857-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,975,757 reads, 35,216,682 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,248 rounds 52401 SRR3207857.ke.tsv 34699 SRR3207857.se.tsv 87100 total ==> SRR3207857.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1757 37.1704 Potri.005G024800.1.v4.1 1035 936 527 22.8578 Potri.004G059700.1.v4.1 961 862 62 2.92001 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 664.145 9.48056 Potri.016G087400.1.v4.1 270 171 1322 313.86 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 233.082 5.65266 Potri.012G127500.1.v4.1 977 878 9010 416.611 ==> SRR3207857.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4427 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 746 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 61 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207857 completed mapping pipeline successfully