Starting /dee2/code/volunteer_pipeline.sh SRR3207858 current disk space = 3054643183616 free memory = 1474681500 SRR3207858 SRAfilesize cf2c938f3844d7662ebef437dd31d811 SRR3207858.sra SRR3207858.sra file validated SRR3207858 is single end SRR3207858 is conventional basespace SRR3207858 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207858_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.36725 34.0 31.0 34.0 31.0 34.0 2 32.78175 34.0 33.0 34.0 31.0 34.0 3 33.122 34.0 34.0 34.0 31.0 34.0 4 36.4655 37.0 37.0 37.0 35.0 37.0 5 36.48975 37.0 37.0 37.0 35.0 37.0 6 36.43375 37.0 37.0 37.0 35.0 37.0 7 36.395 37.0 37.0 37.0 35.0 37.0 8 36.408 37.0 37.0 37.0 35.0 37.0 9 38.2745 39.0 39.0 39.0 37.0 39.0 10-11 38.285 39.0 39.0 39.0 37.0 39.0 12-13 38.2655 39.0 39.0 39.0 37.0 39.0 14-15 39.7725 41.0 40.0 41.0 37.5 41.0 16-17 39.687625 41.0 40.0 41.0 37.0 41.0 18-19 39.78175 41.0 40.0 41.0 38.0 41.0 20-21 39.748125 41.0 40.0 41.0 37.0 41.0 22-23 39.628125 41.0 40.0 41.0 37.0 41.0 24-25 39.6525 41.0 40.0 41.0 37.0 41.0 26-27 39.5135 41.0 40.0 41.0 37.0 41.0 28-29 39.5245 41.0 39.5 41.0 37.0 41.0 30-31 39.291624999999996 40.5 39.0 41.0 36.5 41.0 32-33 39.116875 40.0 39.0 41.0 36.0 41.0 34-35 39.110875 40.0 39.0 41.0 36.0 41.0 36-37 38.856375 40.0 38.0 41.0 35.5 41.0 38-39 38.730374999999995 40.0 38.0 41.0 35.0 41.0 40-41 38.676125 40.0 38.0 41.0 35.0 41.0 42-43 38.773624999999996 40.0 38.0 41.0 35.0 41.0 44-45 38.731125000000006 40.0 38.0 41.0 35.0 41.0 46-47 38.644999999999996 40.0 38.0 41.0 35.0 41.0 48-49 38.46175 40.0 38.0 41.0 34.5 41.0 50-51 38.400999999999996 40.0 38.0 41.0 34.0 41.0 52-53 38.62625 40.0 38.0 41.0 35.0 41.0 54-55 38.588750000000005 40.0 38.5 41.0 35.0 41.0 56-57 38.447500000000005 40.0 38.0 41.0 34.0 41.0 58-59 38.098625 40.0 37.5 41.0 34.0 41.0 60-61 37.56925 40.0 37.0 41.0 33.5 41.0 62-63 37.0745 39.5 36.5 41.0 33.0 41.0 64-65 36.957750000000004 39.0 36.0 41.0 32.0 41.0 66-67 36.885999999999996 39.0 35.5 41.0 32.0 41.0 68-69 36.62525 38.5 35.0 40.0 32.0 41.0 70-71 36.350375 37.0 35.0 39.5 32.0 41.0 72-73 35.410875000000004 37.0 35.0 39.0 30.5 41.0 74-75 35.312 36.0 35.0 39.0 31.0 40.0 76-77 33.781499999999994 35.0 33.5 37.0 29.5 39.0 78-79 34.37175 35.0 34.0 37.0 30.5 39.0 80-81 34.188125 35.0 34.0 37.0 31.0 38.5 82-83 33.97425 35.0 34.0 36.0 31.0 37.0 84-85 33.66437500000001 35.0 34.0 36.0 31.0 37.0 86-87 33.491625 35.0 34.0 35.5 31.0 36.5 88-89 33.115875 35.0 34.0 35.0 29.5 36.0 90-91 32.8465 35.0 34.0 35.0 29.5 36.0 92-93 32.598 35.0 34.0 35.0 29.0 36.0 94-95 32.351 35.0 34.0 35.0 29.0 35.0 96-97 32.033625 35.0 33.0 35.0 27.0 35.0 98-99 31.817 35.0 33.0 35.0 26.5 35.0 100 31.7525 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 1.0 11 4.0 12 3.0 13 4.0 14 5.0 15 3.0 16 4.0 17 5.0 18 6.0 19 4.0 20 7.0 21 6.0 22 11.0 23 7.0 24 11.0 25 8.0 26 16.0 27 20.0 28 27.0 29 39.0 30 43.0 31 52.0 32 59.0 33 97.0 34 142.0 35 220.0 36 354.0 37 905.0 38 1558.0 39 375.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.472179683511996 14.39509954058193 16.84532924961715 43.28739152628892 2 19.8 23.150000000000002 37.225 19.825 3 22.85 26.8 26.625 23.724999999999998 4 23.15578894723681 33.408352088022006 20.155038759689923 23.280820205051263 5 24.05 35.05 23.825 17.075000000000003 6 18.75 36.65 24.9 19.7 7 15.8 18.2 44.7 21.3 8 19.400000000000002 23.45 30.049999999999997 27.1 9 19.975 22.1 32.800000000000004 25.124999999999996 10-11 23.3125 33.025 22.3 21.3625 12-13 20.2125 26.575 29.9875 23.225 14-15 20.549999999999997 28.050000000000004 29.3375 22.0625 16-17 21.8 27.975 28.0875 22.1375 18-19 22.037499999999998 28.15 27.975 21.837500000000002 20-21 21.212500000000002 27.8625 27.6875 23.2375 22-23 21.512500000000003 28.749999999999996 28.212500000000002 21.525 24-25 21.5 27.925 28.3125 22.2625 26-27 21.6 29.049999999999997 27.375 21.975 28-29 21.0625 28.9875 27.5875 22.3625 30-31 22.25 27.025 28.1375 22.5875 32-33 21.337500000000002 29.212500000000002 27.825 21.625 34-35 21.912499999999998 27.925 27.900000000000002 22.2625 36-37 21.075 27.900000000000002 28.050000000000004 22.975 38-39 21.587500000000002 28.675 27.6875 22.05 40-41 21.875 28.3875 27.6125 22.125 42-43 21.5625 28.012500000000003 28.3625 22.0625 44-45 21.587500000000002 27.650000000000002 29.012500000000003 21.75 46-47 21.9625 27.6375 28.199999999999996 22.2 48-49 21.670626484931848 27.84794297861698 27.72289608603226 22.758534450418907 50-51 22.408403151181695 27.960485181943227 27.435288233087405 22.19582343378767 52-53 21.6 28.6375 26.987499999999997 22.775000000000002 54-55 20.5625 28.1 28.762500000000003 22.575 56-57 22.0125 28.299999999999997 27.55 22.1375 58-59 22.018578960582474 28.696962088877733 28.01908109465227 21.26537785588752 60-61 22.229267055541467 28.747146842505707 26.959168146081662 22.064417955871164 62-63 21.653944020356235 29.00763358778626 27.709923664122137 21.62849872773537 64-65 21.595061106211418 29.104195539876525 27.844273655033387 21.45646969887867 66-67 22.1375 28.4375 28.1625 21.2625 68-69 22.8375 29.062500000000004 27.0625 21.0375 70-71 21.3625 28.5875 27.9125 22.1375 72-73 22.0125 28.762500000000003 27.474999999999998 21.75 74-75 21.575 28.4375 27.6 22.3875 76-77 22.193048262065513 27.79444861215304 27.93198299574894 22.080520130032507 78-79 22.3875 28.0875 27.825 21.7 80-81 21.462500000000002 28.3125 27.6375 22.5875 82-83 22.1375 28.0875 28.4 21.375 84-85 21.95 28.199999999999996 28.449999999999996 21.4 86-87 21.712500000000002 28.475 28.262500000000003 21.55 88-89 22.912499999999998 28.6125 27.150000000000002 21.325 90-91 22.400000000000002 28.375 28.1125 21.1125 92-93 22.662499999999998 28.3875 27.224999999999998 21.725 94-95 22.400000000000002 28.6375 27.750000000000004 21.212500000000002 96-97 22.237499999999997 27.925 27.575 22.2625 98-99 21.875 28.125 28.499999999999996 21.5 100 22.175 27.325 28.7 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 1.0 24 2.0 25 2.5 26 5.0 27 5.5 28 4.5 29 12.5 30 21.5 31 24.0 32 30.0 33 44.0 34 59.5 35 78.0 36 105.0 37 123.5 38 140.5 39 164.5 40 205.5 41 241.0 42 239.5 43 248.0 44 281.0 45 293.5 46 269.5 47 248.5 48 212.0 49 179.0 50 158.0 51 121.0 52 109.0 53 93.5 54 61.5 55 42.5 56 31.0 57 27.5 58 25.5 59 16.0 60 11.0 61 13.0 62 9.5 63 4.5 64 5.5 65 4.5 66 2.0 67 0.5 68 1.5 69 3.5 70 2.5 71 1.5 72 1.0 73 1.0 74 1.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 1.5 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0375 50-51 0.0375 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.42500000000000004 60-61 1.425 62-63 1.7500000000000002 64-65 0.7875 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra Read 1043974 spots for SRR3207858.sra Written 1043974 spots for SRR3207858.sra Read 1043972 spots for SRR3207858.sra Written 1043972 spots for SRR3207858.sra SRR ids: ['SRR3207858.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o3he8l1a SRR3207858.sra spots: 20879442 blocks: [[1, 1043972], [1043973, 2087944], [2087945, 3131916], [3131917, 4175888], [4175889, 5219860], [5219861, 6263832], [6263833, 7307804], [7307805, 8351776], [8351777, 9395748], [9395749, 10439720], [10439721, 11483692], [11483693, 12527664], [12527665, 13571636], [13571637, 14615608], [14615609, 15659580], [15659581, 16703552], [16703553, 17747524], [17747525, 18791496], [18791497, 19835468], [19835469, 20879442]] SRR3207858 file size 5433798 SRR3207858 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207858 SRR3207858_1.fastq Input file: SRR3207858_1.fastq trimmed: SRR3207858-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:38:17 2025 >> started Tue Feb 11 09:38:27 2025 >> done (9.636s) 20879442 reads processed; of these: 2647 ( 0.01%) short reads filtered out after trimming by size control 4556 ( 0.02%) empty reads filtered out after trimming by size control 20872239 (99.97%) reads available; of these: 1196239 ( 5.73%) trimmed reads available after processing 19676000 (94.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 440 0.00% 19 583 0.00% 20 718 0.00% 21 961 0.00% 22 1410 0.01% 23 1915 0.01% 24 2527 0.01% 25 3134 0.02% 26 3280 0.02% 27 3158 0.02% 28 3202 0.02% 29 3333 0.02% 30 3453 0.02% 31 3561 0.02% 32 3723 0.02% 33 3707 0.02% 34 3910 0.02% 35 4150 0.02% 36 4118 0.02% 37 4413 0.02% 38 4443 0.02% 39 4603 0.02% 40 4647 0.02% 41 4691 0.02% 42 4985 0.02% 43 5147 0.02% 44 5291 0.03% 45 5588 0.03% 46 6025 0.03% 47 5951 0.03% 48 5764 0.03% 49 5900 0.03% 50 5801 0.03% 51 5890 0.03% 52 6074 0.03% 53 6334 0.03% 54 6615 0.03% 55 6893 0.03% 56 7166 0.03% 57 7370 0.04% 58 7639 0.04% 59 7878 0.04% 60 8152 0.04% 61 8236 0.04% 62 8530 0.04% 63 8334 0.04% 64 8725 0.04% 65 8975 0.04% 66 9788 0.05% 67 9783 0.05% 68 10166 0.05% 69 10499 0.05% 70 11021 0.05% 71 11907 0.06% 72 12309 0.06% 73 12890 0.06% 74 13259 0.06% 75 13812 0.07% 76 7962 0.04% 77 9348 0.04% 78 11139 0.05% 79 12117 0.06% 80 13205 0.06% 81 13945 0.07% 82 14959 0.07% 83 16569 0.08% 84 16950 0.08% 85 18250 0.09% 86 19456 0.09% 87 21282 0.10% 88 23094 0.11% 89 25215 0.12% 90 27537 0.13% 91 30978 0.15% 92 36340 0.17% 93 41638 0.20% 94 49751 0.24% 95 59318 0.28% 96 72603 0.35% 97 87459 0.42% 98 103515 0.50% 99 110832 0.53% 100 19676000 94.27% 20872239 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=71.52 fanout-score-rank=9 prefix-density=0.32 prefix-fanout=32.2 sequence=AGATCGGAAGAGCACACGTCTGAACTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=294.85 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=27.1 sequence=TTCTTCTTCTTC Started job on | Feb 11 09:38:55 Started mapping on | Feb 11 09:38:55 Finished on | Feb 11 09:39:16 Mapping speed, Million of reads per hour | 3578.10 Number of input reads | 20872239 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19980416 Uniquely mapped reads % | 95.73% Average mapped length | 98.67 Number of splices: Total | 5796415 Number of splices: Annotated (sjdb) | 5687061 Number of splices: GT/AG | 5706505 Number of splices: GC/AG | 74051 Number of splices: AT/AC | 5949 Number of splices: Non-canonical | 9910 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 500868 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 288310 % of reads mapped to too many loci | 1.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 390955 390955 390955 N_multimapping 500868 500868 500868 N_noFeature 881919 10272913 10453624 N_ambiguous 206270 35383 35420 UnstrandedReadsAssigned:18892227 PositiveStrandReadsAssigned:9672120 NegativeStrandReadsAssigned:9491372 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207858 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207858-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,872,239 reads, 19,525,624 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR3207858.ke.tsv 34699 SRR3207858.se.tsv 87100 total ==> SRR3207858.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 853 33.0006 Potri.005G024800.1.v4.1 1035 936 305.051 24.1961 Potri.004G059700.1.v4.1 961 862 43 3.70348 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 407.61 10.6405 Potri.016G087400.1.v4.1 270 171 805 349.501 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 132.538 5.87805 Potri.012G127500.1.v4.1 977 878 2430 205.476 ==> SRR3207858.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2123 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 455 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207858 completed mapping pipeline successfully