Starting /dee2/code/volunteer_pipeline.sh SRR3207859 current disk space = 3055515742208 free memory = 1408300736 SRR3207859 SRAfilesize ced0784b984f213a3992f487f9293bb1 SRR3207859.sra SRR3207859.sra file validated SRR3207859 is single end SRR3207859 is conventional basespace SRR3207859 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207859_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6215 34.0 31.0 34.0 31.0 34.0 2 32.89525 34.0 33.0 34.0 31.0 34.0 3 33.1005 34.0 33.0 34.0 31.0 34.0 4 36.438 37.0 37.0 37.0 35.0 37.0 5 36.41725 37.0 37.0 37.0 35.0 37.0 6 36.4695 37.0 37.0 37.0 35.0 37.0 7 36.36525 37.0 37.0 37.0 35.0 37.0 8 36.4025 37.0 37.0 37.0 35.0 37.0 9 38.273 39.0 39.0 39.0 37.0 39.0 10-11 38.1935 39.0 39.0 39.0 37.0 39.0 12-13 38.2055 39.0 39.0 39.0 37.0 39.0 14-15 39.732375 41.0 40.0 41.0 37.5 41.0 16-17 39.705375000000004 41.0 40.0 41.0 37.5 41.0 18-19 39.720625 41.0 40.0 41.0 37.5 41.0 20-21 39.696125 41.0 40.0 41.0 37.0 41.0 22-23 39.537375 41.0 40.0 41.0 37.0 41.0 24-25 39.543875 41.0 40.0 41.0 37.0 41.0 26-27 39.429625 41.0 39.5 41.0 36.5 41.0 28-29 39.367625000000004 41.0 39.0 41.0 37.0 41.0 30-31 39.230000000000004 40.5 39.0 41.0 36.0 41.0 32-33 39.0815 40.0 39.0 41.0 36.0 41.0 34-35 38.948375 40.0 38.5 41.0 35.5 41.0 36-37 38.767250000000004 40.0 38.0 41.0 35.0 41.0 38-39 38.56325 40.0 38.0 41.0 34.5 41.0 40-41 38.547125 40.0 38.0 41.0 34.5 41.0 42-43 38.727000000000004 40.0 38.0 41.0 35.0 41.0 44-45 38.58 40.0 38.0 41.0 34.5 41.0 46-47 38.42975 40.0 38.0 41.0 34.5 41.0 48-49 38.218375 40.0 38.0 41.0 34.0 41.0 50-51 38.159 40.0 38.0 41.0 33.5 41.0 52-53 38.319375 40.0 38.0 41.0 34.0 41.0 54-55 38.344125 40.0 38.0 41.0 34.0 41.0 56-57 38.217875 40.0 38.0 41.0 34.0 41.0 58-59 37.928250000000006 40.0 37.5 41.0 33.5 41.0 60-61 37.582750000000004 40.0 37.0 41.0 33.0 41.0 62-63 37.288875000000004 39.5 36.5 41.0 33.0 41.0 64-65 36.979749999999996 39.0 36.0 41.0 32.5 41.0 66-67 36.74 39.0 35.5 41.0 32.0 41.0 68-69 36.487125000000006 38.0 35.0 40.0 32.0 41.0 70-71 36.041124999999994 37.0 35.0 39.5 31.5 41.0 72-73 35.204625 36.5 35.0 39.0 30.0 41.0 74-75 35.014875 36.0 35.0 39.0 30.5 40.0 76-77 33.45099999999999 35.0 32.5 36.5 28.5 39.0 78-79 33.94175 35.0 34.0 37.0 29.0 39.0 80-81 33.921625 35.0 34.0 37.0 30.0 38.0 82-83 33.660624999999996 35.0 34.0 36.0 30.0 37.0 84-85 33.320375 35.0 34.0 36.0 29.5 37.0 86-87 33.134249999999994 35.0 34.0 35.0 30.0 36.5 88-89 32.763625000000005 35.0 34.0 35.0 29.5 36.0 90-91 32.37325 35.0 34.0 35.0 28.0 36.0 92-93 31.996 35.0 33.0 35.0 26.0 36.0 94-95 31.919375000000002 35.0 33.0 35.0 27.0 35.0 96-97 31.56975 35.0 33.0 35.0 25.0 35.0 98-99 31.345875 35.0 33.0 35.0 24.5 35.0 100 31.44425 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 3.0 12 4.0 13 7.0 14 5.0 15 7.0 16 5.0 17 8.0 18 3.0 19 8.0 20 9.0 21 9.0 22 9.0 23 8.0 24 12.0 25 17.0 26 15.0 27 24.0 28 32.0 29 35.0 30 42.0 31 69.0 32 67.0 33 99.0 34 154.0 35 215.0 36 363.0 37 858.0 38 1569.0 39 341.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.530839231547013 15.267947421638016 17.36602628918099 41.83518705763397 2 19.400000000000002 24.0 35.975 20.625 3 22.675 27.375 27.125 22.825 4 23.29246935201401 32.69952464348261 20.690517888416313 23.317488116087066 5 24.65 35.925000000000004 22.1 17.325 6 18.525 37.625 23.400000000000002 20.45 7 16.879219804951237 17.479369842460617 45.11127781945486 20.530132533133283 8 18.775 23.724999999999998 28.775000000000002 28.725 9 19.525000000000002 23.875 31.874999999999996 24.725 10-11 23.0375 33.137499999999996 22.15 21.675 12-13 20.5875 25.5125 30.7875 23.1125 14-15 20.962500000000002 27.6625 28.000000000000004 23.375 16-17 21.1875 28.4125 27.400000000000002 23.0 18-19 21.5375 29.049999999999997 27.750000000000004 21.6625 20-21 21.3125 28.7 27.650000000000002 22.3375 22-23 22.237499999999997 27.9125 27.037499999999998 22.8125 24-25 20.849999999999998 28.5875 28.075 22.4875 26-27 22.0875 28.225 27.6 22.0875 28-29 22.287499999999998 28.287499999999998 27.6625 21.762500000000003 30-31 21.212500000000002 28.4125 28.449999999999996 21.925 32-33 21.8875 28.487499999999997 28.199999999999996 21.425 34-35 22.925 29.012500000000003 26.700000000000003 21.3625 36-37 21.9625 29.275000000000002 26.924999999999997 21.837500000000002 38-39 22.05 29.799999999999997 27.6625 20.4875 40-41 22.275 28.6125 27.6125 21.5 42-43 21.8625 28.299999999999997 28.075 21.762500000000003 44-45 23.1375 28.3875 27.450000000000003 21.025 46-47 21.65 28.0875 28.499999999999996 21.762500000000003 48-49 22.090112640801003 28.085106382978726 27.697121401752188 22.127659574468083 50-51 22.24030037546934 28.56070087609512 26.921151439299123 22.27784730913642 52-53 22.162499999999998 27.950000000000003 28.287499999999998 21.6 54-55 21.6125 28.3125 27.450000000000003 22.625 56-57 21.85 28.299999999999997 27.962500000000002 21.8875 58-59 22.29882175983956 28.290298320381048 27.776385058912005 21.634494860867385 60-61 20.736165385100215 29.497037690659273 27.240640363040463 22.52615656120005 62-63 22.039888916940168 29.500126230749814 27.543549608684675 20.916435243625347 64-65 22.367429002261872 28.273435536566975 27.883890424729827 21.47524503644132 66-67 21.462500000000002 29.175 27.6375 21.725 68-69 21.625 27.375 29.625 21.375 70-71 22.6 28.237499999999997 27.900000000000002 21.2625 72-73 21.7375 27.8875 28.462500000000002 21.912499999999998 74-75 22.705676419104776 28.91972993248312 27.70692673168292 20.667666916729182 76-77 21.9942449643438 28.39984986863506 27.699236832228202 21.906668334792943 78-79 21.775 28.3625 28.6375 21.224999999999998 80-81 22.3125 28.575 27.212500000000002 21.9 82-83 21.575 28.3125 27.875 22.237499999999997 84-85 21.912499999999998 28.1125 27.875 22.1 86-87 22.1875 28.425 27.9375 21.45 88-89 22.7625 28.499999999999996 28.0875 20.65 90-91 23.025000000000002 27.8375 27.750000000000004 21.3875 92-93 22.8375 29.037499999999998 27.1375 20.9875 94-95 22.55 28.125 27.5625 21.762500000000003 96-97 22.5 27.224999999999998 28.4125 21.8625 98-99 22.75 28.487499999999997 28.199999999999996 20.5625 100 22.650000000000002 28.175 27.0 22.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 2.0 25 3.0 26 3.5 27 6.5 28 9.5 29 12.5 30 21.0 31 32.0 32 42.0 33 47.5 34 52.5 35 73.0 36 100.0 37 122.0 38 137.5 39 153.5 40 204.0 41 240.5 42 248.5 43 260.0 44 261.0 45 270.5 46 256.5 47 240.5 48 231.5 49 185.0 50 154.5 51 144.0 52 116.0 53 87.5 54 67.5 55 48.0 56 32.5 57 20.0 58 23.5 59 24.0 60 11.0 61 8.5 62 7.5 63 6.5 64 5.0 65 3.5 66 2.5 67 3.0 68 2.0 69 0.0 70 0.0 71 2.0 72 2.5 73 1.5 74 1.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.125 50-51 0.125 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.27499999999999997 60-61 0.8375 62-63 0.975 64-65 0.525 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.025 76-77 0.08750000000000001 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88 0.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770115 spots for SRR3207859.sra Written 770115 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra Read 770098 spots for SRR3207859.sra Written 770098 spots for SRR3207859.sra SRR ids: ['SRR3207859.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x015vir7 SRR3207859.sra spots: 15401977 blocks: [[1, 770098], [770099, 1540196], [1540197, 2310294], [2310295, 3080392], [3080393, 3850490], [3850491, 4620588], [4620589, 5390686], [5390687, 6160784], [6160785, 6930882], [6930883, 7700980], [7700981, 8471078], [8471079, 9241176], [9241177, 10011274], [10011275, 10781372], [10781373, 11551470], [11551471, 12321568], [12321569, 13091666], [13091667, 13861764], [13861765, 14631862], [14631863, 15401977]] SRR3207859 file size 4005416 SRR3207859 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207859 SRR3207859_1.fastq Input file: SRR3207859_1.fastq trimmed: SRR3207859-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:04:50 2025 >> started Tue Feb 11 09:04:58 2025 >> done (7.784s) 15401977 reads processed; of these: 1923 ( 0.01%) short reads filtered out after trimming by size control 6255 ( 0.04%) empty reads filtered out after trimming by size control 15393799 (99.95%) reads available; of these: 936629 ( 6.08%) trimmed reads available after processing 14457170 (93.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 334 0.00% 19 480 0.00% 20 564 0.00% 21 746 0.00% 22 1034 0.01% 23 1461 0.01% 24 1957 0.01% 25 2466 0.02% 26 3141 0.02% 27 2866 0.02% 28 2640 0.02% 29 2491 0.02% 30 2715 0.02% 31 2774 0.02% 32 2791 0.02% 33 3026 0.02% 34 3040 0.02% 35 3241 0.02% 36 3378 0.02% 37 3492 0.02% 38 3412 0.02% 39 3626 0.02% 40 3728 0.02% 41 3709 0.02% 42 3874 0.03% 43 3964 0.03% 44 3967 0.03% 45 4370 0.03% 46 4588 0.03% 47 4696 0.03% 48 5003 0.03% 49 4739 0.03% 50 4533 0.03% 51 4522 0.03% 52 4848 0.03% 53 5024 0.03% 54 5203 0.03% 55 5475 0.04% 56 5518 0.04% 57 5781 0.04% 58 6000 0.04% 59 6256 0.04% 60 6767 0.04% 61 6862 0.04% 62 7126 0.05% 63 6577 0.04% 64 6978 0.05% 65 7309 0.05% 66 7975 0.05% 67 8232 0.05% 68 8325 0.05% 69 8223 0.05% 70 8810 0.06% 71 9201 0.06% 72 9764 0.06% 73 10023 0.07% 74 10351 0.07% 75 11008 0.07% 76 6322 0.04% 77 7199 0.05% 78 8664 0.06% 79 9639 0.06% 80 10279 0.07% 81 11112 0.07% 82 11752 0.08% 83 12918 0.08% 84 13465 0.09% 85 14146 0.09% 86 15286 0.10% 87 16883 0.11% 88 18092 0.12% 89 19646 0.13% 90 21757 0.14% 91 24521 0.16% 92 28177 0.18% 93 32492 0.21% 94 39143 0.25% 95 46271 0.30% 96 56206 0.37% 97 67222 0.44% 98 79416 0.52% 99 85017 0.55% 100 14457170 93.92% 15393799 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=82.44 fanout-score-rank=4 prefix-density=0.94 prefix-fanout=41.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=7 fanout-score=175.46 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=23.7 sequence=AAGAAGAAGAAA Started job on | Feb 11 09:05:24 Started mapping on | Feb 11 09:05:24 Finished on | Feb 11 09:05:39 Mapping speed, Million of reads per hour | 3694.51 Number of input reads | 15393799 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 14754835 Uniquely mapped reads % | 95.85% Average mapped length | 98.45 Number of splices: Total | 4149930 Number of splices: Annotated (sjdb) | 4067500 Number of splices: GT/AG | 4084485 Number of splices: GC/AG | 53272 Number of splices: AT/AC | 4310 Number of splices: Non-canonical | 7863 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364432 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 183014 % of reads mapped to too many loci | 1.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 274532 274532 274532 N_multimapping 364432 364432 364432 N_noFeature 664724 7593733 7720595 N_ambiguous 157463 26361 26158 UnstrandedReadsAssigned:13932648 PositiveStrandReadsAssigned:7134741 NegativeStrandReadsAssigned:7008082 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207859 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207859-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,393,799 reads, 14,377,201 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR3207859.ke.tsv 34699 SRR3207859.se.tsv 87100 total ==> SRR3207859.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 501 26.5014 Potri.005G024800.1.v4.1 1035 936 185 20.0633 Potri.004G059700.1.v4.1 961 862 17 2.00192 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 266.395 9.50829 Potri.016G087400.1.v4.1 270 171 529.514 314.331 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 63 3.82024 Potri.012G127500.1.v4.1 977 878 2496 288.573 ==> SRR3207859.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1490 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 367 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207859 completed mapping pipeline successfully