Starting /dee2/code/volunteer_pipeline.sh SRR3207860 current disk space = 3053697490944 free memory = 1579159368 SRR3207860 SRAfilesize 353b7f952a142acda203432990176745 SRR3207860.sra SRR3207860.sra file validated SRR3207860 is single end SRR3207860 is conventional basespace SRR3207860 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207860_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.836 34.0 31.0 34.0 31.0 34.0 2 32.52225 34.0 31.0 34.0 31.0 34.0 3 32.95275 34.0 33.0 34.0 31.0 34.0 4 36.44 37.0 37.0 37.0 35.0 37.0 5 36.4185 37.0 37.0 37.0 35.0 37.0 6 36.423 37.0 37.0 37.0 35.0 37.0 7 36.38375 37.0 37.0 37.0 35.0 37.0 8 36.3795 37.0 37.0 37.0 35.0 37.0 9 38.19075 39.0 39.0 39.0 37.0 39.0 10-11 38.24375 39.0 39.0 39.0 37.0 39.0 12-13 38.18925 39.0 39.0 39.0 37.0 39.0 14-15 39.705375000000004 41.0 40.0 41.0 37.0 41.0 16-17 39.682625 41.0 40.0 41.0 37.0 41.0 18-19 39.604375 41.0 40.0 41.0 37.0 41.0 20-21 39.59587500000001 41.0 40.0 41.0 37.0 41.0 22-23 39.61825 41.0 40.0 41.0 37.0 41.0 24-25 39.5995 41.0 40.0 41.0 37.0 41.0 26-27 39.464875000000006 41.0 39.5 41.0 37.0 41.0 28-29 39.39325 41.0 39.0 41.0 36.0 41.0 30-31 39.19075 40.5 39.0 41.0 36.0 41.0 32-33 39.20825 40.0 39.0 41.0 36.0 41.0 34-35 39.09275 40.0 39.0 41.0 35.5 41.0 36-37 38.919875000000005 40.0 38.5 41.0 35.0 41.0 38-39 38.848 40.0 38.0 41.0 35.0 41.0 40-41 38.785250000000005 40.0 38.0 41.0 35.0 41.0 42-43 38.751625000000004 40.0 38.0 41.0 35.0 41.0 44-45 38.653875 40.0 38.0 41.0 35.0 41.0 46-47 38.54675 40.0 38.0 41.0 34.0 41.0 48-49 38.252125 40.0 38.0 41.0 33.5 41.0 50-51 38.335499999999996 40.0 38.0 41.0 34.0 41.0 52-53 38.670249999999996 40.0 38.0 41.0 34.5 41.0 54-55 38.649 40.0 38.0 41.0 35.0 41.0 56-57 38.597750000000005 40.0 38.0 41.0 35.0 41.0 58-59 38.2715 40.0 37.5 41.0 34.0 41.0 60-61 38.070125000000004 40.0 37.0 41.0 34.0 41.0 62-63 37.747 39.5 36.5 41.0 33.0 41.0 64-65 37.434625 39.0 36.0 41.0 33.0 41.0 66-67 37.286500000000004 39.0 36.0 41.0 33.0 41.0 68-69 36.98675 38.5 35.0 40.0 33.0 41.0 70-71 36.53075 37.0 35.0 39.5 32.0 41.0 72-73 35.98325 37.0 35.0 39.0 32.0 41.0 74-75 35.5305 36.0 35.0 39.0 31.0 40.0 76-77 34.089625 35.0 33.5 37.0 29.5 39.0 78-79 34.388875 35.0 34.0 37.0 30.0 39.0 80-81 34.356375 35.0 34.0 36.5 31.0 38.0 82-83 34.080625 35.0 34.0 36.0 31.0 37.0 84-85 33.856125 35.0 34.0 36.0 31.0 37.0 86-87 33.518125 35.0 34.0 35.5 30.0 36.5 88-89 33.32725000000001 35.0 34.0 35.0 30.0 36.0 90-91 33.199749999999995 35.0 34.0 35.0 30.0 36.0 92-93 33.14425 35.0 34.0 35.0 30.0 36.0 94-95 32.964875 35.0 34.0 35.0 30.0 35.5 96-97 32.538375 35.0 34.0 35.0 29.0 35.0 98-99 32.38475 35.0 34.0 35.0 29.0 35.0 100 32.33325 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 2.0 13 2.0 14 4.0 15 1.0 16 4.0 17 4.0 18 6.0 19 4.0 20 3.0 21 4.0 22 5.0 23 11.0 24 7.0 25 16.0 26 15.0 27 15.0 28 31.0 29 25.0 30 42.0 31 57.0 32 73.0 33 108.0 34 132.0 35 190.0 36 352.0 37 930.0 38 1580.0 39 374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.71676600155481 14.019175952319255 18.502202643171806 40.76185540295413 2 18.75 23.875 36.975 20.4 3 22.95 25.474999999999998 28.4 23.175 4 24.725 32.550000000000004 20.775 21.95 5 24.6 35.375 22.35 17.675 6 18.925 38.275 23.150000000000002 19.650000000000002 7 17.375 16.875 45.324999999999996 20.424999999999997 8 18.575 24.3 30.049999999999997 27.075 9 21.15 21.725 31.75 25.374999999999996 10-11 22.625 34.65 22.2 20.525 12-13 21.25 25.937500000000004 30.162499999999998 22.650000000000002 14-15 21.25 28.262500000000003 28.7375 21.75 16-17 22.3125 28.3125 27.487499999999997 21.8875 18-19 22.037499999999998 27.9375 27.800000000000004 22.225 20-21 21.0375 28.6375 27.900000000000002 22.425 22-23 21.95 28.762500000000003 27.025 22.2625 24-25 21.5625 28.0625 28.025 22.35 26-27 21.725 28.525 27.275 22.475 28-29 21.45 27.675 28.425 22.45 30-31 20.7875 29.225 27.5875 22.400000000000002 32-33 20.2625 29.062500000000004 28.3125 22.3625 34-35 22.05 28.8625 27.1375 21.95 36-37 22.25 28.6125 27.8875 21.25 38-39 21.8 29.362500000000004 27.325 21.512500000000003 40-41 22.025 28.675 27.287499999999998 22.0125 42-43 22.225 29.025000000000002 28.1 20.65 44-45 22.3375 28.012500000000003 27.6375 22.0125 46-47 22.6125 27.437499999999996 27.0625 22.8875 48-49 21.583093660122547 28.435663373765163 28.248093034888083 21.73314993122421 50-51 22.344551482547228 27.348930314024773 28.825222069310648 21.481296134117354 52-53 22.620982868575716 28.848318119294735 26.760035013129922 21.770663998999627 54-55 21.5375 28.075 28.1375 22.25 56-57 21.7875 28.487499999999997 27.6625 22.0625 58-59 22.5875 27.6625 27.825 21.925 60-61 21.675 27.725 28.8625 21.7375 62-63 20.724999999999998 29.4375 28.037499999999998 21.8 64-65 22.3875 28.4375 28.175 21.0 66-67 22.4375 27.762500000000003 27.987499999999997 21.8125 68-69 22.112499999999997 28.449999999999996 27.35 22.0875 70-71 22.725 27.175 27.9125 22.1875 72-73 22.0125 27.962500000000002 28.825 21.2 74-75 22.879659744808606 27.90843132349262 28.083562672004003 21.128346259694773 76-77 22.50719379457025 29.21306142875016 27.361441261103465 20.918303515576127 78-79 21.608103038639488 28.810804051519316 27.77291484306615 21.808178066775042 80-81 22.95 28.5625 27.075 21.4125 82-83 22.5125 27.450000000000003 28.050000000000004 21.987499999999997 84-85 22.6375 28.9375 26.7625 21.6625 86-87 22.25 28.075 27.625 22.05 88-89 22.45 28.125 27.750000000000004 21.675 90-91 21.987499999999997 28.675 27.6125 21.725 92-93 21.349999999999998 29.025000000000002 28.237499999999997 21.3875 94-95 22.6375 28.287499999999998 27.6125 21.462500000000002 96-97 22.925 28.1375 27.287499999999998 21.65 98-99 22.4625 28.537499999999998 27.762500000000003 21.2375 100 22.825 27.3 28.675 21.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 2.0 23 1.5 24 0.0 25 0.5 26 3.0 27 7.0 28 7.5 29 13.5 30 17.5 31 18.0 32 37.0 33 56.5 34 62.0 35 73.0 36 102.5 37 122.5 38 142.5 39 165.5 40 185.0 41 217.0 42 249.0 43 256.0 44 272.0 45 280.0 46 255.5 47 238.5 48 224.0 49 203.0 50 168.0 51 140.5 52 111.0 53 82.0 54 66.5 55 54.5 56 41.5 57 29.5 58 22.0 59 15.5 60 11.5 61 7.5 62 5.5 63 6.0 64 4.0 65 2.5 66 4.0 67 3.0 68 1.5 69 1.0 70 0.0 71 0.5 72 1.5 73 1.0 74 0.5 75 1.0 76 0.5 77 1.0 78 1.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0375 50-51 0.08750000000000001 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.075 76-77 0.08750000000000001 78-79 0.0375 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221316 spots for SRR3207860.sra Written 2221316 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra Read 2221313 spots for SRR3207860.sra Written 2221313 spots for SRR3207860.sra SRR ids: ['SRR3207860.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gueobdlr SRR3207860.sra spots: 44426263 blocks: [[1, 2221313], [2221314, 4442626], [4442627, 6663939], [6663940, 8885252], [8885253, 11106565], [11106566, 13327878], [13327879, 15549191], [15549192, 17770504], [17770505, 19991817], [19991818, 22213130], [22213131, 24434443], [24434444, 26655756], [26655757, 28877069], [28877070, 31098382], [31098383, 33319695], [33319696, 35541008], [35541009, 37762321], [37762322, 39983634], [39983635, 42204947], [42204948, 44426263]] SRR3207860 file size 11574218 SRR3207860 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207860 SRR3207860_1.fastq Input file: SRR3207860_1.fastq trimmed: SRR3207860-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:09:23 2025 >> started Tue Feb 11 10:09:46 2025 >> done (23.843s) 44426263 reads processed; of these: 4924 ( 0.01%) short reads filtered out after trimming by size control 13433 ( 0.03%) empty reads filtered out after trimming by size control 44407906 (99.96%) reads available; of these: 2495058 ( 5.62%) trimmed reads available after processing 41912848 (94.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1056 0.00% 19 1265 0.00% 20 1612 0.00% 21 2091 0.00% 22 3152 0.01% 23 4342 0.01% 24 5620 0.01% 25 7428 0.02% 26 7015 0.02% 27 6962 0.02% 28 7373 0.02% 29 7189 0.02% 30 7933 0.02% 31 8022 0.02% 32 8401 0.02% 33 8472 0.02% 34 9115 0.02% 35 9326 0.02% 36 9695 0.02% 37 10132 0.02% 38 10049 0.02% 39 10884 0.02% 40 10462 0.02% 41 11354 0.03% 42 11455 0.03% 43 11769 0.03% 44 12382 0.03% 45 12622 0.03% 46 13542 0.03% 47 13888 0.03% 48 13318 0.03% 49 13210 0.03% 50 13084 0.03% 51 13295 0.03% 52 13270 0.03% 53 14263 0.03% 54 14762 0.03% 55 15426 0.03% 56 15895 0.04% 57 17914 0.04% 58 17551 0.04% 59 17500 0.04% 60 17612 0.04% 61 18447 0.04% 62 18908 0.04% 63 18461 0.04% 64 19139 0.04% 65 19859 0.04% 66 21601 0.05% 67 21267 0.05% 68 21850 0.05% 69 22287 0.05% 70 23577 0.05% 71 24680 0.06% 72 26555 0.06% 73 28034 0.06% 74 28935 0.07% 75 29714 0.07% 76 16491 0.04% 77 18948 0.04% 78 22541 0.05% 79 25732 0.06% 80 27445 0.06% 81 29326 0.07% 82 31447 0.07% 83 34275 0.08% 84 35564 0.08% 85 37867 0.09% 86 40487 0.09% 87 44067 0.10% 88 49597 0.11% 89 53761 0.12% 90 57887 0.13% 91 65857 0.15% 92 74548 0.17% 93 86237 0.19% 94 99541 0.22% 95 122565 0.28% 96 146156 0.33% 97 172070 0.39% 98 200438 0.45% 99 217189 0.49% 100 41912848 94.38% 44407906 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=75.51 fanout-score-rank=5 prefix-density=0.65 prefix-fanout=40.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=165.66 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=23.2 sequence=AAGAAGAAGAAA Started job on | Feb 11 10:10:05 Started mapping on | Feb 11 10:10:05 Finished on | Feb 11 10:10:42 Mapping speed, Million of reads per hour | 4320.77 Number of input reads | 44407906 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 42652690 Uniquely mapped reads % | 96.05% Average mapped length | 98.54 Number of splices: Total | 11933637 Number of splices: Annotated (sjdb) | 11712997 Number of splices: GT/AG | 11750716 Number of splices: GC/AG | 149602 Number of splices: AT/AC | 12072 Number of splices: Non-canonical | 21247 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1024296 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 494680 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 730920 730920 730920 N_multimapping 1024296 1024296 1024296 N_noFeature 1845387 21945001 22226876 N_ambiguous 472791 73630 73658 UnstrandedReadsAssigned:40334512 PositiveStrandReadsAssigned:20634059 NegativeStrandReadsAssigned:20352156 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207860 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207860-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,407,906 reads, 41,596,498 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52401 SRR3207860.ke.tsv 34699 SRR3207860.se.tsv 87100 total ==> SRR3207860.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1531 28.0695 Potri.005G024800.1.v4.1 1035 936 324 12.1788 Potri.004G059700.1.v4.1 961 862 73 2.97955 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 657.959 8.13961 Potri.016G087400.1.v4.1 270 171 1751.52 360.375 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 161.521 3.39475 Potri.012G127500.1.v4.1 977 878 7418 297.253 ==> SRR3207860.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5494 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 920 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 48 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207860 completed mapping pipeline successfully