Starting /dee2/code/volunteer_pipeline.sh SRR3207861 current disk space = 3053287952384 free memory = 1579552568 SRR3207861 SRAfilesize 134dd349999c2022ec204bf4afb28559 SRR3207861.sra SRR3207861.sra file validated SRR3207861 is single end SRR3207861 is conventional basespace SRR3207861 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207861_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.067 34.0 31.0 34.0 31.0 34.0 2 32.66 34.0 33.0 34.0 31.0 34.0 3 33.00075 34.0 33.0 34.0 31.0 34.0 4 36.43575 37.0 37.0 37.0 35.0 37.0 5 36.35925 37.0 37.0 37.0 35.0 37.0 6 36.40425 37.0 37.0 37.0 35.0 37.0 7 36.373 37.0 37.0 37.0 35.0 37.0 8 36.41 37.0 37.0 37.0 35.0 37.0 9 38.11375 39.0 39.0 39.0 37.0 39.0 10-11 38.235375 39.0 39.0 39.0 37.0 39.0 12-13 38.189 39.0 39.0 39.0 37.0 39.0 14-15 39.770250000000004 41.0 40.0 41.0 37.0 41.0 16-17 39.726625 41.0 40.0 41.0 37.0 41.0 18-19 39.617625000000004 41.0 40.0 41.0 37.0 41.0 20-21 39.620625000000004 41.0 40.0 41.0 37.0 41.0 22-23 39.579750000000004 41.0 40.0 41.0 37.0 41.0 24-25 39.539874999999995 41.0 40.0 41.0 37.0 41.0 26-27 39.45975 41.0 39.0 41.0 36.5 41.0 28-29 39.360875 41.0 39.0 41.0 36.5 41.0 30-31 39.196 41.0 39.0 41.0 36.0 41.0 32-33 39.170500000000004 40.0 39.0 41.0 36.0 41.0 34-35 39.117875 40.0 39.0 41.0 36.0 41.0 36-37 38.9665 40.0 38.5 41.0 35.5 41.0 38-39 38.767375 40.0 38.0 41.0 35.0 41.0 40-41 38.727625 40.0 38.0 41.0 35.0 41.0 42-43 38.772875 40.0 38.0 41.0 35.0 41.0 44-45 38.636625 40.0 38.0 41.0 35.0 41.0 46-47 38.532875000000004 40.0 38.0 41.0 34.5 41.0 48-49 38.3505 40.0 38.0 41.0 34.0 41.0 50-51 38.3625 40.0 38.0 41.0 34.0 41.0 52-53 38.642875000000004 40.0 38.0 41.0 35.0 41.0 54-55 38.67875 40.0 38.5 41.0 35.0 41.0 56-57 38.5215 40.0 38.0 41.0 34.0 41.0 58-59 38.21525 40.0 38.0 41.0 34.0 41.0 60-61 37.992625000000004 40.0 37.0 41.0 33.5 41.0 62-63 37.570625 39.5 36.5 41.0 33.0 41.0 64-65 37.3155 39.0 36.0 41.0 32.5 41.0 66-67 37.116125 39.0 36.0 41.0 33.0 41.0 68-69 36.800124999999994 38.5 35.0 40.0 33.0 41.0 70-71 36.34625 37.0 35.0 39.5 32.0 41.0 72-73 35.873125 37.0 35.0 39.0 32.0 41.0 74-75 35.361374999999995 36.0 35.0 39.0 31.0 40.0 76-77 33.929125 35.0 33.5 37.0 29.5 39.0 78-79 34.326875 35.0 34.0 37.0 30.5 39.0 80-81 34.23725 35.0 34.0 37.0 31.0 38.5 82-83 33.997625 35.0 34.0 36.0 31.0 37.0 84-85 33.65025 35.0 34.0 36.0 30.5 37.0 86-87 33.370375 35.0 34.0 35.5 30.0 36.5 88-89 33.154875000000004 35.0 34.0 35.0 30.0 36.0 90-91 33.03025 35.0 34.0 35.0 30.0 36.0 92-93 32.93375 35.0 34.0 35.0 30.0 36.0 94-95 32.70525 35.0 34.0 35.0 29.0 35.5 96-97 32.373625000000004 35.0 34.0 35.0 29.0 35.0 98-99 32.181 35.0 34.0 35.0 29.0 35.0 100 32.043 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 2.0 11 0.0 12 3.0 13 5.0 14 3.0 15 2.0 16 2.0 17 4.0 18 5.0 19 9.0 20 7.0 21 7.0 22 8.0 23 11.0 24 14.0 25 9.0 26 14.0 27 20.0 28 28.0 29 37.0 30 35.0 31 52.0 32 73.0 33 87.0 34 114.0 35 211.0 36 357.0 37 860.0 38 1640.0 39 376.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.99922859346876 14.065312419645155 17.253792748778608 41.68166623810748 2 18.9 24.925 36.55 19.625 3 23.075000000000003 27.85 26.525 22.55 4 24.15 33.525 19.825 22.5 5 24.3 35.125 22.475 18.099999999999998 6 18.5 37.95 23.974999999999998 19.575 7 16.8 18.25 43.9 21.05 8 20.625 23.0 30.025000000000002 26.35 9 19.0 23.45 31.424999999999997 26.125 10-11 23.200000000000003 33.4875 22.3 21.0125 12-13 20.4875 27.05 29.612500000000004 22.85 14-15 20.7375 28.249999999999996 29.4875 21.525 16-17 22.125 27.85 27.737499999999997 22.287499999999998 18-19 21.4875 28.0625 28.237499999999997 22.2125 20-21 22.3125 27.425 27.237499999999997 23.025000000000002 22-23 21.5375 28.237499999999997 28.4 21.825 24-25 21.6125 28.199999999999996 28.225 21.9625 26-27 22.225 28.1 27.975 21.7 28-29 21.85 27.987499999999997 27.775 22.3875 30-31 22.075 28.675 26.724999999999998 22.525000000000002 32-33 21.512500000000003 28.65 28.199999999999996 21.637500000000003 34-35 21.7 28.275 28.249999999999996 21.775 36-37 22.4625 28.1375 27.287499999999998 22.112499999999997 38-39 22.55 27.35 27.925 22.175 40-41 22.15 29.037499999999998 27.025 21.7875 42-43 21.65 28.725 27.712500000000002 21.912499999999998 44-45 21.9625 28.512500000000003 27.5875 21.9375 46-47 22.112499999999997 28.4375 27.9125 21.5375 48-49 22.696011004126547 27.885457046392396 27.77291484306615 21.645617106414903 50-51 21.987235640095108 28.682267550994865 27.39331748216744 21.937179326742584 52-53 22.84606727522821 27.92297111416781 27.61035388270601 21.620607727897962 54-55 21.099999999999998 28.512500000000003 27.3875 23.0 56-57 21.1875 28.812500000000004 28.1375 21.8625 58-59 22.075 28.299999999999997 27.962500000000002 21.6625 60-61 21.4375 28.512500000000003 28.025 22.025 62-63 21.087500000000002 28.6125 28.262500000000003 22.037499999999998 64-65 22.1 28.375 28.65 20.875 66-67 21.75 29.325000000000003 27.224999999999998 21.7 68-69 22.375 27.825 27.962500000000002 21.837500000000002 70-71 22.525000000000002 28.037499999999998 27.800000000000004 21.637500000000003 72-73 21.1125 28.1875 28.3375 22.3625 74-75 21.819091705242087 28.70011259852371 27.911922932565997 21.56887276366821 76-77 22.08036049568156 28.952309425460008 27.500312930279136 21.467017148579295 78-79 21.548274137068535 28.139069534767387 28.2016008004002 22.11105552776388 80-81 22.15 28.0625 27.775 22.0125 82-83 22.4875 27.712500000000002 28.375 21.425 84-85 22.1875 27.825 27.875 22.112499999999997 86-87 22.6125 28.65 27.212500000000002 21.525 88-89 23.0625 28.799999999999997 26.7625 21.375 90-91 22.3 28.249999999999996 27.775 21.675 92-93 22.7375 27.6375 27.950000000000003 21.675 94-95 22.3125 28.525 27.750000000000004 21.4125 96-97 22.5125 28.5625 27.462500000000002 21.462500000000002 98-99 22.9625 28.762500000000003 26.875 21.4 100 23.175 29.625 25.8 21.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 5.5 25 7.0 26 4.0 27 6.0 28 9.0 29 11.5 30 15.0 31 22.5 32 32.5 33 44.0 34 62.0 35 76.5 36 92.0 37 115.0 38 138.5 39 163.5 40 196.0 41 224.0 42 234.0 43 251.0 44 273.5 45 283.5 46 278.5 47 262.5 48 226.0 49 187.0 50 165.5 51 138.5 52 111.5 53 83.5 54 61.5 55 46.0 56 35.0 57 27.5 58 21.5 59 17.5 60 9.5 61 7.0 62 9.5 63 8.5 64 7.0 65 6.0 66 2.0 67 1.0 68 1.5 69 3.0 70 3.5 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0375 50-51 0.11249999999999999 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.08750000000000001 76-77 0.13749999999999998 78-79 0.05 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700490 spots for SRR3207861.sra Written 1700490 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra Read 1700476 spots for SRR3207861.sra Written 1700476 spots for SRR3207861.sra SRR ids: ['SRR3207861.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1hyemnbd SRR3207861.sra spots: 34009534 blocks: [[1, 1700476], [1700477, 3400952], [3400953, 5101428], [5101429, 6801904], [6801905, 8502380], [8502381, 10202856], [10202857, 11903332], [11903333, 13603808], [13603809, 15304284], [15304285, 17004760], [17004761, 18705236], [18705237, 20405712], [20405713, 22106188], [22106189, 23806664], [23806665, 25507140], [25507141, 27207616], [27207617, 28908092], [28908093, 30608568], [30608569, 32309044], [32309045, 34009534]] SRR3207861 file size 8857851 SRR3207861 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207861 SRR3207861_1.fastq Input file: SRR3207861_1.fastq trimmed: SRR3207861-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:28:22 2025 >> started Tue Feb 11 10:28:39 2025 >> done (16.907s) 34009534 reads processed; of these: 4742 ( 0.01%) short reads filtered out after trimming by size control 11701 ( 0.03%) empty reads filtered out after trimming by size control 33993091 (99.95%) reads available; of these: 1885059 ( 5.55%) trimmed reads available after processing 32108032 (94.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 900 0.00% 19 1129 0.00% 20 1331 0.00% 21 1709 0.01% 22 2395 0.01% 23 3498 0.01% 24 4578 0.01% 25 5993 0.02% 26 5605 0.02% 27 5768 0.02% 28 5830 0.02% 29 5831 0.02% 30 6164 0.02% 31 6395 0.02% 32 6571 0.02% 33 6594 0.02% 34 7009 0.02% 35 7157 0.02% 36 7672 0.02% 37 7795 0.02% 38 7853 0.02% 39 8240 0.02% 40 8247 0.02% 41 8462 0.02% 42 8842 0.03% 43 9049 0.03% 44 9325 0.03% 45 9825 0.03% 46 10279 0.03% 47 10602 0.03% 48 10317 0.03% 49 10109 0.03% 50 10080 0.03% 51 9983 0.03% 52 10346 0.03% 53 10601 0.03% 54 11113 0.03% 55 11769 0.03% 56 12316 0.04% 57 13511 0.04% 58 13194 0.04% 59 13183 0.04% 60 13484 0.04% 61 13803 0.04% 62 14115 0.04% 63 14206 0.04% 64 14345 0.04% 65 15431 0.05% 66 17598 0.05% 67 16012 0.05% 68 16427 0.05% 69 16916 0.05% 70 17546 0.05% 71 18506 0.05% 72 19819 0.06% 73 21272 0.06% 74 21529 0.06% 75 22333 0.07% 76 12406 0.04% 77 14384 0.04% 78 17025 0.05% 79 19128 0.06% 80 20943 0.06% 81 22377 0.07% 82 23645 0.07% 83 25673 0.08% 84 26898 0.08% 85 28347 0.08% 86 30441 0.09% 87 33169 0.10% 88 37053 0.11% 89 40451 0.12% 90 43683 0.13% 91 49297 0.15% 92 55938 0.16% 93 65000 0.19% 94 74702 0.22% 95 92298 0.27% 96 109883 0.32% 97 128601 0.38% 98 150940 0.44% 99 162265 0.48% 100 32108032 94.45% 33993091 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=79.83 fanout-score-rank=5 prefix-density=1.24 prefix-fanout=41.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=256.41 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=28.0 sequence=TTCTTCTTCTTT Started job on | Feb 11 10:29:00 Started mapping on | Feb 11 10:29:00 Finished on | Feb 11 10:29:29 Mapping speed, Million of reads per hour | 4219.83 Number of input reads | 33993091 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 32520513 Uniquely mapped reads % | 95.67% Average mapped length | 98.41 Number of splices: Total | 9196971 Number of splices: Annotated (sjdb) | 9017794 Number of splices: GT/AG | 9053300 Number of splices: GC/AG | 116110 Number of splices: AT/AC | 9347 Number of splices: Non-canonical | 18214 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 825819 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 460594 % of reads mapped to too many loci | 1.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 646759 646759 646759 N_multimapping 825819 825819 825819 N_noFeature 1458629 16766778 16968069 N_ambiguous 360722 58532 58504 UnstrandedReadsAssigned:30701162 PositiveStrandReadsAssigned:15695203 NegativeStrandReadsAssigned:15493940 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207861 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207861-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,993,091 reads, 31,763,888 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52401 SRR3207861.ke.tsv 34699 SRR3207861.se.tsv 87100 total ==> SRR3207861.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1411 34.5298 Potri.005G024800.1.v4.1 1035 936 259 12.9947 Potri.004G059700.1.v4.1 961 862 51 2.77847 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 542.863 8.96402 Potri.016G087400.1.v4.1 270 171 1261 346.307 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 162.567 4.56056 Potri.012G127500.1.v4.1 977 878 4546 243.152 ==> SRR3207861.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4424 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 651 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 44 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207861 completed mapping pipeline successfully