Starting /dee2/code/volunteer_pipeline.sh SRR3207862 current disk space = 3054996791296 free memory = 1405084240 SRR3207862 SRAfilesize 02113bedd3a2c59f40b25f8fb1a091cf SRR3207862.sra SRR3207862.sra file validated SRR3207862 is single end SRR3207862 is conventional basespace SRR3207862 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207862_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09 34.0 31.0 34.0 31.0 34.0 2 32.67725 34.0 33.0 34.0 31.0 34.0 3 33.0415 34.0 33.0 34.0 31.0 34.0 4 36.462 37.0 37.0 37.0 35.0 37.0 5 36.42475 37.0 37.0 37.0 35.0 37.0 6 36.4325 37.0 37.0 37.0 35.0 37.0 7 36.425 37.0 37.0 37.0 35.0 37.0 8 36.41375 37.0 37.0 37.0 35.0 37.0 9 38.24025 39.0 39.0 39.0 37.0 39.0 10-11 38.299625 39.0 39.0 39.0 37.0 39.0 12-13 38.224374999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.802875 41.0 40.0 41.0 38.0 41.0 16-17 39.821 41.0 40.0 41.0 38.0 41.0 18-19 39.685500000000005 41.0 40.0 41.0 37.0 41.0 20-21 39.691375 41.0 40.0 41.0 37.5 41.0 22-23 39.672125 41.0 40.0 41.0 37.0 41.0 24-25 39.689 41.0 40.0 41.0 37.5 41.0 26-27 39.551 41.0 40.0 41.0 37.0 41.0 28-29 39.46425 41.0 40.0 41.0 37.0 41.0 30-31 39.3425 41.0 39.0 41.0 37.0 41.0 32-33 39.327124999999995 41.0 39.0 41.0 36.0 41.0 34-35 39.2545 40.0 39.0 41.0 36.5 41.0 36-37 39.050124999999994 40.0 38.5 41.0 35.5 41.0 38-39 38.936875 40.0 38.0 41.0 35.5 41.0 40-41 38.87775 40.0 38.5 41.0 35.0 41.0 42-43 38.917375 40.0 38.5 41.0 35.0 41.0 44-45 38.802125000000004 40.0 38.0 41.0 35.0 41.0 46-47 38.722 40.0 38.0 41.0 34.5 41.0 48-49 38.472125 40.0 38.0 41.0 34.5 41.0 50-51 38.53125 40.0 38.0 41.0 34.5 41.0 52-53 38.789874999999995 40.0 38.5 41.0 35.0 41.0 54-55 38.795874999999995 40.0 38.0 41.0 35.0 41.0 56-57 38.67225 40.0 38.0 41.0 35.0 41.0 58-59 38.421125 40.0 37.5 41.0 34.0 41.0 60-61 38.1475 40.0 37.0 41.0 34.0 41.0 62-63 37.7285 39.5 36.5 41.0 33.0 41.0 64-65 37.4335 39.0 36.0 41.0 33.0 41.0 66-67 37.22825 39.0 36.0 41.0 33.0 41.0 68-69 36.796499999999995 38.0 35.0 40.0 33.0 41.0 70-71 36.391000000000005 37.0 35.0 39.5 32.5 41.0 72-73 35.8925 37.0 35.0 39.0 32.0 41.0 74-75 35.381125 36.0 35.0 39.0 31.5 40.0 76-77 34.050250000000005 35.0 33.5 37.0 29.5 39.0 78-79 34.367999999999995 35.0 34.0 37.0 30.5 39.0 80-81 34.31075 35.0 34.0 36.5 31.0 38.0 82-83 34.01349999999999 35.0 34.0 36.0 31.0 37.0 84-85 33.7545 35.0 34.0 36.0 31.0 37.0 86-87 33.413624999999996 35.0 34.0 35.5 30.5 36.5 88-89 33.20875 35.0 34.0 35.0 30.0 36.0 90-91 33.119375000000005 35.0 34.0 35.0 30.0 36.0 92-93 32.962125 35.0 34.0 35.0 30.0 36.0 94-95 32.748875 35.0 34.0 35.0 29.5 35.0 96-97 32.47825 35.0 34.0 35.0 29.0 35.0 98-99 32.36125 35.0 34.0 35.0 29.0 35.0 100 32.27 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 4.0 14 2.0 15 0.0 16 2.0 17 8.0 18 3.0 19 5.0 20 6.0 21 10.0 22 7.0 23 8.0 24 12.0 25 16.0 26 27.0 27 22.0 28 21.0 29 32.0 30 34.0 31 47.0 32 55.0 33 79.0 34 113.0 35 199.0 36 361.0 37 883.0 38 1680.0 39 360.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.283505154639172 15.38659793814433 16.90721649484536 42.422680412371136 2 19.2 24.3 36.55 19.950000000000003 3 21.725 27.1 27.900000000000002 23.275000000000002 4 24.0 33.025 20.875 22.1 5 25.1 35.199999999999996 21.75 17.95 6 18.275 37.7 24.4 19.625 7 16.075 17.625 43.85 22.45 8 19.375 22.875 29.975 27.775 9 19.575 22.400000000000002 32.15 25.874999999999996 10-11 22.25 33.575 22.5 21.675 12-13 20.474999999999998 26.3 29.6625 23.5625 14-15 21.425 26.875 29.725 21.975 16-17 22.0125 28.287499999999998 26.825 22.875 18-19 22.1 28.9 27.437499999999996 21.5625 20-21 21.7375 28.287499999999998 26.974999999999998 23.0 22-23 21.325 29.425 27.474999999999998 21.775 24-25 21.875 29.175 26.3625 22.5875 26-27 21.5625 29.675 26.325 22.4375 28-29 21.3125 29.062500000000004 28.037499999999998 21.587500000000002 30-31 21.4 28.6625 27.450000000000003 22.4875 32-33 20.9875 29.4875 26.8125 22.7125 34-35 21.425 29.0875 26.937499999999996 22.55 36-37 21.6125 28.525 26.325 23.5375 38-39 21.5 28.275 26.825 23.400000000000002 40-41 21.8625 28.1125 27.487499999999997 22.537499999999998 42-43 21.2875 28.999999999999996 27.250000000000004 22.4625 44-45 22.1 28.025 28.1 21.775 46-47 21.0125 29.15 27.437499999999996 22.400000000000002 48-49 21.6875 28.3625 27.35 22.6 50-51 22.22777847230904 28.153519189898734 27.765970746343292 21.852731591448933 52-53 22.35 29.4375 27.6375 20.575 54-55 22.3625 28.125 27.1375 22.375 56-57 21.9 28.462500000000002 26.7625 22.875 58-59 21.4125 28.9875 27.212500000000002 22.3875 60-61 21.45 29.425 27.650000000000002 21.475 62-63 22.175 27.737499999999997 27.3875 22.7 64-65 21.587500000000002 29.5875 26.625 22.2 66-67 21.224999999999998 28.712500000000002 27.437499999999996 22.625 68-69 22.125 27.8125 27.537499999999998 22.525000000000002 70-71 22.9625 27.925 26.987499999999997 22.125 72-73 21.6625 27.950000000000003 28.537499999999998 21.85 74-75 21.190148768596075 28.316039504938118 28.2410301287661 22.252781597699713 76-77 21.94298574643661 27.74443610902726 28.369592398099524 21.94298574643661 78-79 22.0625 27.3 27.900000000000002 22.7375 80-81 21.75 28.5625 27.712500000000002 21.975 82-83 22.6875 28.15 27.6 21.5625 84-85 22.125 27.575 27.975 22.325 86-87 21.775 28.199999999999996 28.1625 21.8625 88-89 21.85 28.537499999999998 28.0625 21.55 90-91 23.0875 27.700000000000003 27.487499999999997 21.725 92-93 21.462500000000002 28.0875 28.325 22.125 94-95 21.8625 28.1 27.650000000000002 22.3875 96-97 22.275 26.8375 28.025 22.8625 98-99 22.662499999999998 28.1 27.0 22.237499999999997 100 21.475 29.125 27.325 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 3.0 28 7.5 29 10.5 30 12.0 31 23.5 32 34.5 33 43.5 34 65.0 35 79.5 36 99.0 37 126.5 38 137.5 39 160.5 40 191.0 41 205.0 42 228.5 43 263.5 44 278.5 45 274.5 46 271.5 47 254.0 48 216.0 49 175.0 50 161.0 51 146.0 52 115.0 53 98.5 54 73.5 55 51.0 56 41.0 57 31.0 58 19.5 59 16.5 60 16.5 61 12.0 62 9.5 63 8.5 64 5.5 65 2.5 66 2.5 67 3.5 68 2.5 69 2.0 70 3.0 71 2.5 72 3.5 73 2.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92492492492492 99.825 2 0.050050050050050046 0.1 3 0.025025025025025023 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra Read 1748258 spots for SRR3207862.sra Written 1748258 spots for SRR3207862.sra Read 1748246 spots for SRR3207862.sra Written 1748246 spots for SRR3207862.sra SRR ids: ['SRR3207862.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z8s6d5mf SRR3207862.sra spots: 34964932 blocks: [[1, 1748246], [1748247, 3496492], [3496493, 5244738], [5244739, 6992984], [6992985, 8741230], [8741231, 10489476], [10489477, 12237722], [12237723, 13985968], [13985969, 15734214], [15734215, 17482460], [17482461, 19230706], [19230707, 20978952], [20978953, 22727198], [22727199, 24475444], [24475445, 26223690], [26223691, 27971936], [27971937, 29720182], [29720183, 31468428], [31468429, 33216674], [33216675, 34964932]] SRR3207862 file size 9106954 SRR3207862 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207862 SRR3207862_1.fastq Input file: SRR3207862_1.fastq trimmed: SRR3207862-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:23:47 2025 >> started Tue Feb 11 09:24:06 2025 >> done (19.159s) 34964932 reads processed; of these: 4992 ( 0.01%) short reads filtered out after trimming by size control 8437 ( 0.02%) empty reads filtered out after trimming by size control 34951503 (99.96%) reads available; of these: 1963756 ( 5.62%) trimmed reads available after processing 32987747 (94.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 853 0.00% 19 1028 0.00% 20 1300 0.00% 21 1822 0.01% 22 2459 0.01% 23 3574 0.01% 24 4715 0.01% 25 5960 0.02% 26 5857 0.02% 27 5712 0.02% 28 5763 0.02% 29 5925 0.02% 30 6241 0.02% 31 6555 0.02% 32 6897 0.02% 33 6790 0.02% 34 7306 0.02% 35 7421 0.02% 36 7853 0.02% 37 8079 0.02% 38 8205 0.02% 39 8287 0.02% 40 9066 0.03% 41 8978 0.03% 42 9194 0.03% 43 9297 0.03% 44 9970 0.03% 45 10122 0.03% 46 10729 0.03% 47 10828 0.03% 48 10481 0.03% 49 10385 0.03% 50 10142 0.03% 51 10189 0.03% 52 10597 0.03% 53 11197 0.03% 54 11541 0.03% 55 12054 0.03% 56 12763 0.04% 57 14035 0.04% 58 15392 0.04% 59 13815 0.04% 60 14237 0.04% 61 14398 0.04% 62 14923 0.04% 63 14769 0.04% 64 14956 0.04% 65 15826 0.05% 66 17848 0.05% 67 16849 0.05% 68 17260 0.05% 69 17552 0.05% 70 18754 0.05% 71 19779 0.06% 72 20802 0.06% 73 22076 0.06% 74 22590 0.06% 75 23165 0.07% 76 12888 0.04% 77 14795 0.04% 78 17854 0.05% 79 20203 0.06% 80 21724 0.06% 81 23262 0.07% 82 24779 0.07% 83 27053 0.08% 84 27794 0.08% 85 29461 0.08% 86 31572 0.09% 87 34670 0.10% 88 38616 0.11% 89 42297 0.12% 90 45037 0.13% 91 51414 0.15% 92 57939 0.17% 93 67462 0.19% 94 78427 0.22% 95 96265 0.28% 96 114672 0.33% 97 133718 0.38% 98 156398 0.45% 99 170295 0.49% 100 32987747 94.38% 34951503 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=72.77 fanout-score-rank=6 prefix-density=0.65 prefix-fanout=39.4 sequence=AGATCGGAAGAGCACACGTCTGAACTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=257.54 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.3 sequence=TTCTTCTTCTTT Started job on | Feb 11 09:24:25 Started mapping on | Feb 11 09:24:26 Finished on | Feb 11 09:24:58 Mapping speed, Million of reads per hour | 3932.04 Number of input reads | 34951503 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 33329300 Uniquely mapped reads % | 95.36% Average mapped length | 98.56 Number of splices: Total | 9112345 Number of splices: Annotated (sjdb) | 8947376 Number of splices: GT/AG | 8971552 Number of splices: GC/AG | 113974 Number of splices: AT/AC | 9675 Number of splices: Non-canonical | 17144 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 1.95 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 822867 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 624013 % of reads mapped to too many loci | 1.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 799336 799336 799336 N_multimapping 822867 822867 822867 N_noFeature 1362452 17099411 17335136 N_ambiguous 367447 55394 55393 UnstrandedReadsAssigned:31599401 PositiveStrandReadsAssigned:16174495 NegativeStrandReadsAssigned:15938771 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207862 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207862-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,951,503 reads, 32,789,130 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,277 rounds 52401 SRR3207862.ke.tsv 34699 SRR3207862.se.tsv 87100 total ==> SRR3207862.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1492 33.5515 Potri.005G024800.1.v4.1 1035 936 271 12.4943 Potri.004G059700.1.v4.1 961 862 124 6.20772 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 522.364 7.92614 Potri.016G087400.1.v4.1 270 171 1361 343.463 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 144 3.71214 Potri.012G127500.1.v4.1 977 878 7139 350.881 ==> SRR3207862.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3701 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 725 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 76 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207862 completed mapping pipeline successfully