Starting /dee2/code/volunteer_pipeline.sh SRR3207863 current disk space = 3053161234432 free memory = 1573770900 SRR3207863 SRAfilesize dbafdd31f2397c973d2a2f3df45a6346 SRR3207863.sra SRR3207863.sra file validated SRR3207863 is single end SRR3207863 is conventional basespace SRR3207863 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207863_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7365 34.0 31.0 34.0 31.0 34.0 2 32.513 34.0 33.0 34.0 31.0 34.0 3 33.01025 34.0 33.0 34.0 31.0 34.0 4 36.489 37.0 37.0 37.0 35.0 37.0 5 36.413 37.0 37.0 37.0 35.0 37.0 6 36.4325 37.0 37.0 37.0 35.0 37.0 7 36.49125 37.0 37.0 37.0 35.0 37.0 8 36.42625 37.0 37.0 37.0 35.0 37.0 9 38.13 39.0 39.0 39.0 37.0 39.0 10-11 38.28425 39.0 39.0 39.0 37.0 39.0 12-13 38.226625 39.0 39.0 39.0 37.0 39.0 14-15 39.807249999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.754374999999996 41.0 40.0 41.0 38.0 41.0 18-19 39.75812500000001 41.0 40.0 41.0 37.5 41.0 20-21 39.649125 41.0 40.0 41.0 37.0 41.0 22-23 39.583749999999995 41.0 40.0 41.0 37.0 41.0 24-25 39.564875 41.0 40.0 41.0 37.0 41.0 26-27 39.368624999999994 41.0 39.5 41.0 36.5 41.0 28-29 39.309625 41.0 39.0 41.0 36.5 41.0 30-31 39.21925 41.0 39.0 41.0 36.0 41.0 32-33 39.162875 40.0 39.0 41.0 36.0 41.0 34-35 38.96625 40.0 39.0 41.0 36.0 41.0 36-37 38.872 40.0 38.5 41.0 35.0 41.0 38-39 38.683125000000004 40.0 38.0 41.0 35.0 41.0 40-41 38.656125 40.0 38.0 41.0 35.0 41.0 42-43 38.55775 40.0 38.0 41.0 34.5 41.0 44-45 38.586749999999995 40.0 38.0 41.0 34.5 41.0 46-47 38.30275 40.0 38.0 41.0 34.0 41.0 48-49 38.199 40.0 38.0 41.0 33.5 41.0 50-51 38.3845 40.0 38.0 41.0 34.0 41.0 52-53 38.549499999999995 40.0 38.5 41.0 34.5 41.0 54-55 38.535375 40.0 38.5 41.0 34.5 41.0 56-57 38.463375 40.0 38.0 41.0 35.0 41.0 58-59 38.209125 40.0 37.5 41.0 34.0 41.0 60-61 37.90625 40.0 37.0 41.0 33.5 41.0 62-63 37.668375 39.5 37.0 41.0 33.0 41.0 64-65 37.33175 39.0 36.0 41.0 33.0 41.0 66-67 36.961 39.0 36.0 41.0 32.5 41.0 68-69 36.6475 38.0 35.0 40.0 32.0 41.0 70-71 36.258250000000004 37.0 35.0 39.5 32.0 41.0 72-73 35.719625 37.0 35.0 39.0 31.0 41.0 74-75 35.179625 36.0 35.0 39.0 31.0 40.0 76-77 33.678625 34.5 33.0 36.5 29.0 39.0 78-79 34.3125 35.0 34.0 37.0 30.0 39.0 80-81 34.010374999999996 35.0 34.0 36.5 30.5 38.5 82-83 33.801249999999996 35.0 34.0 36.0 30.0 37.0 84-85 33.5305 35.0 34.0 36.0 30.0 37.0 86-87 33.320875 35.0 34.0 35.5 30.0 36.5 88-89 33.03425 35.0 34.0 35.0 29.0 36.0 90-91 32.848375 35.0 34.0 35.0 29.0 36.0 92-93 32.766999999999996 35.0 34.0 35.0 29.5 36.0 94-95 32.5325 35.0 34.0 35.0 29.0 35.5 96-97 32.350875 35.0 34.0 35.0 29.0 35.0 98-99 32.204875 35.0 34.0 35.0 29.0 35.0 100 32.03225 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 2.0 9 3.0 10 2.0 11 4.0 12 5.0 13 4.0 14 3.0 15 2.0 16 5.0 17 2.0 18 5.0 19 7.0 20 7.0 21 10.0 22 10.0 23 14.0 24 8.0 25 15.0 26 7.0 27 25.0 28 26.0 29 23.0 30 31.0 31 66.0 32 69.0 33 101.0 34 107.0 35 194.0 36 344.0 37 934.0 38 1582.0 39 381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.286757038581857 14.259645464025025 18.22210636079249 42.231491136600624 2 20.025000000000002 24.075 35.725 20.175 3 23.05 27.375 27.425 22.15 4 23.875 32.824999999999996 20.25 23.05 5 25.474999999999998 35.025 21.425 18.075 6 18.625 38.175 23.925 19.275000000000002 7 17.625 17.599999999999998 43.25 21.525 8 19.875 23.925 28.799999999999997 27.400000000000002 9 21.349999999999998 23.875 30.475 24.3 10-11 22.7625 33.4125 22.325 21.5 12-13 19.775000000000002 25.25 30.599999999999998 24.375 14-15 21.25 26.8375 28.499999999999996 23.4125 16-17 21.675 28.225 27.3875 22.7125 18-19 20.962500000000002 27.8625 28.0875 23.0875 20-21 22.6125 28.287499999999998 27.6125 21.4875 22-23 22.2625 28.050000000000004 27.537499999999998 22.15 24-25 21.7 28.6125 27.762500000000003 21.925 26-27 22.3375 28.275 26.825 22.5625 28-29 22.825 27.775 26.937499999999996 22.4625 30-31 22.2625 28.175 27.3625 22.2 32-33 22.675 28.3875 26.875 22.0625 34-35 21.7875 28.8875 27.3375 21.987499999999997 36-37 20.8 29.012500000000003 27.6875 22.5 38-39 22.3125 28.225 28.287499999999998 21.175 40-41 22.375 27.787499999999998 27.500000000000004 22.3375 42-43 21.4375 28.4125 28.299999999999997 21.85 44-45 22.7375 28.3625 27.237499999999997 21.6625 46-47 22.35 27.8875 27.800000000000004 21.9625 48-49 21.712500000000002 28.262500000000003 28.000000000000004 22.025 50-51 21.224999999999998 28.262500000000003 27.3625 23.150000000000002 52-53 21.1125 29.075 26.987499999999997 22.825 54-55 21.087500000000002 28.4375 27.8875 22.5875 56-57 21.9625 28.4 28.487499999999997 21.15 58-59 21.6625 28.375 27.800000000000004 22.162499999999998 60-61 21.9 27.987499999999997 27.800000000000004 22.3125 62-63 21.9 27.9125 28.025 22.162499999999998 64-65 21.3625 28.575 28.6625 21.4 66-67 21.912499999999998 28.1 28.1 21.8875 68-69 22.037499999999998 27.975 28.1375 21.85 70-71 21.8125 28.262500000000003 28.1875 21.7375 72-73 22.075 27.675 28.6625 21.587500000000002 74-75 20.837500000000002 27.700000000000003 29.1625 22.3 76-77 22.7375 27.187499999999996 27.525 22.55 78-79 21.85 28.075 28.225 21.85 80-81 22.7125 27.9375 27.962500000000002 21.3875 82-83 22.8125 28.075 27.6375 21.475 84-85 21.912499999999998 27.875 28.999999999999996 21.212500000000002 86-87 23.1875 28.4 26.700000000000003 21.712500000000002 88-89 21.9625 28.1 28.287499999999998 21.65 90-91 22.2125 27.6375 28.237499999999997 21.912499999999998 92-93 22.412499999999998 28.0875 28.025 21.475 94-95 22.037499999999998 28.1875 27.250000000000004 22.525000000000002 96-97 22.0 28.0625 28.0625 21.875 98-99 22.9625 27.6375 27.975 21.425 100 22.475 28.125 26.724999999999998 22.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 3.5 26 6.5 27 7.5 28 8.5 29 13.5 30 18.5 31 22.5 32 32.5 33 45.5 34 58.5 35 74.5 36 90.0 37 108.0 38 142.5 39 166.5 40 171.5 41 199.0 42 241.5 43 270.5 44 273.0 45 268.0 46 267.5 47 259.5 48 228.5 49 190.0 50 158.0 51 137.0 52 122.0 53 104.5 54 79.0 55 52.0 56 41.0 57 28.5 58 23.5 59 18.5 60 8.5 61 7.5 62 10.5 63 10.5 64 6.0 65 2.5 66 3.5 67 3.5 68 2.5 69 1.5 70 0.5 71 1.5 72 1.5 73 1.5 74 1.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.1000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166984 spots for SRR3207863.sra Written 2166984 spots for SRR3207863.sra Read 2166986 spots for SRR3207863.sra Written 2166986 spots for SRR3207863.sra SRR ids: ['SRR3207863.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cbe2njq_ SRR3207863.sra spots: 43339682 blocks: [[1, 2166984], [2166985, 4333968], [4333969, 6500952], [6500953, 8667936], [8667937, 10834920], [10834921, 13001904], [13001905, 15168888], [15168889, 17335872], [17335873, 19502856], [19502857, 21669840], [21669841, 23836824], [23836825, 26003808], [26003809, 28170792], [28170793, 30337776], [30337777, 32504760], [32504761, 34671744], [34671745, 36838728], [36838729, 39005712], [39005713, 41172696], [41172697, 43339682]] SRR3207863 file size 11290889 SRR3207863 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207863 SRR3207863_1.fastq Input file: SRR3207863_1.fastq trimmed: SRR3207863-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:35:13 2025 >> started Tue Feb 11 10:35:37 2025 >> done (24.110s) 43339682 reads processed; of these: 5322 ( 0.01%) short reads filtered out after trimming by size control 15653 ( 0.04%) empty reads filtered out after trimming by size control 43318707 (99.95%) reads available; of these: 2511372 ( 5.80%) trimmed reads available after processing 40807335 (94.20%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 970 0.00% 19 1298 0.00% 20 1573 0.00% 21 2111 0.00% 22 2950 0.01% 23 4206 0.01% 24 5285 0.01% 25 6657 0.02% 26 6622 0.02% 27 6459 0.01% 28 6619 0.02% 29 7039 0.02% 30 7454 0.02% 31 7515 0.02% 32 8116 0.02% 33 8070 0.02% 34 8504 0.02% 35 8803 0.02% 36 9195 0.02% 37 9307 0.02% 38 9497 0.02% 39 10116 0.02% 40 10294 0.02% 41 11725 0.03% 42 11704 0.03% 43 11390 0.03% 44 11675 0.03% 45 12412 0.03% 46 12805 0.03% 47 13264 0.03% 48 12582 0.03% 49 12519 0.03% 50 12508 0.03% 51 12576 0.03% 52 13263 0.03% 53 14337 0.03% 54 14802 0.03% 55 15313 0.04% 56 15872 0.04% 57 19532 0.05% 58 18547 0.04% 59 18061 0.04% 60 17954 0.04% 61 18291 0.04% 62 18508 0.04% 63 18795 0.04% 64 19079 0.04% 65 19745 0.05% 66 21661 0.05% 67 20925 0.05% 68 21671 0.05% 69 22195 0.05% 70 23688 0.05% 71 24691 0.06% 72 25453 0.06% 73 26587 0.06% 74 27196 0.06% 75 28609 0.07% 76 16337 0.04% 77 19132 0.04% 78 22857 0.05% 79 25586 0.06% 80 27125 0.06% 81 29537 0.07% 82 31743 0.07% 83 34141 0.08% 84 35192 0.08% 85 37446 0.09% 86 39840 0.09% 87 44071 0.10% 88 48306 0.11% 89 53517 0.12% 90 58501 0.14% 91 65810 0.15% 92 75506 0.17% 93 86434 0.20% 94 102151 0.24% 95 121493 0.28% 96 147672 0.34% 97 174201 0.40% 98 207875 0.48% 99 238304 0.55% 100 40807335 94.20% 43318707 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=82.54 fanout-score-rank=4 prefix-density=0.71 prefix-fanout=41.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=178.47 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=23.8 sequence=AAGAAGAAGAAA Started job on | Feb 11 10:36:14 Started mapping on | Feb 11 10:36:14 Finished on | Feb 11 10:37:20 Mapping speed, Million of reads per hour | 2362.84 Number of input reads | 43318707 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 39477755 Uniquely mapped reads % | 91.13% Average mapped length | 98.53 Number of splices: Total | 11371292 Number of splices: Annotated (sjdb) | 11156651 Number of splices: GT/AG | 11194926 Number of splices: GC/AG | 144930 Number of splices: AT/AC | 11292 Number of splices: Non-canonical | 20144 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 983067 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 700236 % of reads mapped to too many loci | 1.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.93% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2857885 2857885 2857885 N_multimapping 983067 983067 983067 N_noFeature 1685785 20353071 20541815 N_ambiguous 402576 67395 67177 UnstrandedReadsAssigned:37389394 PositiveStrandReadsAssigned:19057289 NegativeStrandReadsAssigned:18868763 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207863 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207863-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,318,707 reads, 38,754,453 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR3207863.ke.tsv 34699 SRR3207863.se.tsv 87100 total ==> SRR3207863.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1402 27.6859 Potri.005G024800.1.v4.1 1035 936 205 8.29971 Potri.004G059700.1.v4.1 961 862 52 2.28603 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 740.869 9.87181 Potri.016G087400.1.v4.1 270 171 1783.54 395.249 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 162 3.66729 Potri.012G127500.1.v4.1 977 878 6459 278.776 ==> SRR3207863.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3958 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 771 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207863 completed mapping pipeline successfully