Starting /dee2/code/volunteer_pipeline.sh SRR3207864 current disk space = 3053035814912 free memory = 1579299404 SRR3207864 SRAfilesize 8436e3a42b717e2eab5140e49a9088f9 SRR3207864.sra SRR3207864.sra file validated SRR3207864 is single end SRR3207864 is conventional basespace SRR3207864 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207864_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.744 34.0 31.0 34.0 30.0 34.0 2 31.94175 34.0 31.0 34.0 30.0 34.0 3 32.8355 34.0 31.0 34.0 30.0 34.0 4 36.3725 37.0 37.0 37.0 35.0 37.0 5 36.358 37.0 37.0 37.0 35.0 37.0 6 36.4455 37.0 37.0 37.0 35.0 37.0 7 36.47775 37.0 37.0 37.0 35.0 37.0 8 36.36325 37.0 37.0 37.0 35.0 37.0 9 38.1465 39.0 39.0 39.0 37.0 39.0 10-11 38.254875 39.0 39.0 39.0 37.0 39.0 12-13 38.208 39.0 39.0 39.0 37.0 39.0 14-15 39.805625 41.0 40.0 41.0 38.0 41.0 16-17 39.726875 41.0 40.0 41.0 37.0 41.0 18-19 39.69 41.0 40.0 41.0 37.5 41.0 20-21 39.7235 41.0 40.0 41.0 37.0 41.0 22-23 39.653875 41.0 40.0 41.0 37.0 41.0 24-25 39.657250000000005 41.0 40.0 41.0 37.0 41.0 26-27 39.410125 41.0 39.5 41.0 36.5 41.0 28-29 39.397999999999996 41.0 39.5 41.0 37.0 41.0 30-31 39.2785 41.0 39.0 41.0 36.0 41.0 32-33 39.148 40.0 39.0 41.0 36.0 41.0 34-35 39.077124999999995 40.0 39.0 41.0 36.0 41.0 36-37 38.9705 40.0 39.0 41.0 36.0 41.0 38-39 38.82025 40.0 38.0 41.0 35.0 41.0 40-41 38.803375 40.0 38.0 41.0 35.0 41.0 42-43 38.75875 40.0 38.0 41.0 35.0 41.0 44-45 38.794875000000005 40.0 38.0 41.0 35.0 41.0 46-47 38.505 40.0 38.0 41.0 34.5 41.0 48-49 38.388374999999996 40.0 38.0 41.0 34.0 41.0 50-51 38.4815 40.0 38.0 41.0 34.5 41.0 52-53 38.681375 40.0 39.0 41.0 35.0 41.0 54-55 38.698625 40.0 38.5 41.0 35.0 41.0 56-57 38.61825 40.0 38.0 41.0 35.0 41.0 58-59 38.385374999999996 40.0 38.0 41.0 34.0 41.0 60-61 38.085125 40.0 37.0 41.0 34.0 41.0 62-63 37.852000000000004 40.0 37.0 41.0 34.0 41.0 64-65 37.39925 39.0 36.0 41.0 33.0 41.0 66-67 37.125875 39.0 36.0 41.0 33.0 41.0 68-69 36.760625 38.5 35.0 40.0 32.5 41.0 70-71 36.392625 37.0 35.0 39.5 32.0 41.0 72-73 35.782875 37.0 35.0 39.0 31.0 41.0 74-75 35.260999999999996 36.0 35.0 39.0 31.0 40.0 76-77 33.864875 35.0 33.0 37.0 29.5 39.0 78-79 34.381625 35.0 34.0 37.0 30.5 39.0 80-81 34.181125 35.0 34.0 36.5 30.5 38.5 82-83 33.9345 35.0 34.0 36.0 31.0 37.0 84-85 33.5035 35.0 34.0 36.0 30.0 37.0 86-87 33.3765 35.0 34.0 35.5 30.0 36.5 88-89 33.07575 35.0 34.0 35.0 29.0 36.0 90-91 32.90075 35.0 34.0 35.0 29.0 36.0 92-93 32.864000000000004 35.0 34.0 35.0 29.0 36.0 94-95 32.678875000000005 35.0 34.0 35.0 29.0 35.5 96-97 32.402375000000006 35.0 34.0 35.0 29.0 35.0 98-99 32.341125 35.0 34.0 35.0 29.0 35.0 100 32.017 35.0 33.0 35.0 28.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 2.0 9 1.0 10 3.0 11 2.0 12 3.0 13 3.0 14 3.0 15 3.0 16 2.0 17 9.0 18 2.0 19 6.0 20 7.0 21 3.0 22 6.0 23 8.0 24 9.0 25 9.0 26 15.0 27 14.0 28 28.0 29 41.0 30 51.0 31 52.0 32 62.0 33 83.0 34 135.0 35 209.0 36 346.0 37 912.0 38 1597.0 39 373.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.57323981656326 14.405179390342596 18.532506069598057 41.48907472349609 2 20.150000000000002 23.525 37.075 19.25 3 23.275000000000002 26.150000000000002 27.025 23.549999999999997 4 24.6 33.025 20.225 22.15 5 24.2 35.875 22.0 17.925 6 17.65 39.45 24.4 18.5 7 17.325 15.575 46.25 20.849999999999998 8 19.775000000000002 23.175 28.875 28.175 9 19.2 23.775 31.7 25.324999999999996 10-11 23.1875 33.825 22.0875 20.9 12-13 20.4375 26.7625 29.625 23.175 14-15 20.5 27.2625 29.95 22.287499999999998 16-17 22.525000000000002 28.1125 27.462500000000002 21.9 18-19 21.4875 28.462500000000002 27.6625 22.3875 20-21 22.0125 28.425 27.150000000000002 22.412499999999998 22-23 22.6125 28.1 27.962500000000002 21.325 24-25 22.025 27.787499999999998 27.5125 22.675 26-27 21.6625 28.875 27.737499999999997 21.725 28-29 21.837500000000002 27.762500000000003 28.549999999999997 21.85 30-31 22.075 27.950000000000003 27.6875 22.287499999999998 32-33 22.162499999999998 28.787499999999998 26.974999999999998 22.075 34-35 22.2625 27.6625 27.987499999999997 22.0875 36-37 21.762500000000003 28.712500000000002 28.4375 21.087500000000002 38-39 21.975 28.6625 27.525 21.837500000000002 40-41 21.4125 28.4375 27.400000000000002 22.75 42-43 21.3125 29.1375 27.712500000000002 21.837500000000002 44-45 22.5875 27.437499999999996 27.650000000000002 22.325 46-47 21.5625 28.3375 27.8375 22.2625 48-49 21.708140552707263 27.035138176816304 28.698261848193074 22.558459422283356 50-51 21.335667833916958 28.73936968484242 27.963981990995496 21.96098049024512 52-53 22.352794099262407 28.416052006500813 27.378422302787847 21.852731591448933 54-55 21.9 28.1125 28.1 21.8875 56-57 22.9625 27.8625 27.650000000000002 21.525 58-59 21.75 28.000000000000004 28.1125 22.1375 60-61 21.6125 27.6375 28.3625 22.3875 62-63 22.3 27.775 28.025 21.9 64-65 22.175 28.349999999999998 27.575 21.9 66-67 21.875 28.075 28.237499999999997 21.8125 68-69 22.5 27.437499999999996 28.199999999999996 21.8625 70-71 22.8 28.075 26.6625 22.4625 72-73 21.0375 28.575 29.1625 21.224999999999998 74-75 22.433412529698636 26.860072527197698 28.848318119294735 21.858196823808928 76-77 21.14807403701851 27.62631315657829 28.77688844422211 22.448724362181093 78-79 21.265158144768094 28.391048881110137 28.641080135016878 21.702712839104887 80-81 21.8 28.287499999999998 27.437499999999996 22.475 82-83 22.237499999999997 28.6125 27.9375 21.212500000000002 84-85 20.837500000000002 28.175 28.5875 22.400000000000002 86-87 22.3375 28.787499999999998 27.325 21.55 88-89 22.3125 28.287499999999998 27.950000000000003 21.45 90-91 21.2875 28.537499999999998 28.275 21.9 92-93 21.8875 28.050000000000004 27.737499999999997 22.325 94-95 22.5875 28.0875 28.1875 21.1375 96-97 22.225 28.675 27.8375 21.2625 98-99 22.83070767691923 28.33208302075519 26.744186046511626 22.093023255813954 100 22.900000000000002 27.85 27.675 21.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.5 26 6.5 27 6.5 28 9.0 29 15.0 30 16.5 31 21.0 32 34.5 33 42.5 34 56.0 35 76.5 36 89.0 37 108.5 38 134.5 39 164.0 40 204.0 41 224.5 42 237.0 43 268.0 44 289.0 45 283.0 46 257.0 47 245.0 48 230.0 49 201.0 50 171.0 51 147.0 52 117.0 53 83.5 54 67.5 55 48.0 56 31.0 57 26.0 58 21.0 59 17.0 60 13.5 61 7.5 62 3.5 63 3.0 64 4.0 65 3.0 66 4.0 67 3.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.324999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0375 50-51 0.05 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0375 76-77 0.05 78-79 0.0125 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.025 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222898 spots for SRR3207864.sra Written 3222898 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra Read 3222893 spots for SRR3207864.sra Written 3222893 spots for SRR3207864.sra SRR ids: ['SRR3207864.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hxndqa7r SRR3207864.sra spots: 64457865 blocks: [[1, 3222893], [3222894, 6445786], [6445787, 9668679], [9668680, 12891572], [12891573, 16114465], [16114466, 19337358], [19337359, 22560251], [22560252, 25783144], [25783145, 29006037], [29006038, 32228930], [32228931, 35451823], [35451824, 38674716], [38674717, 41897609], [41897610, 45120502], [45120503, 48343395], [48343396, 51566288], [51566289, 54789181], [54789182, 58012074], [58012075, 61234967], [61234968, 64457865]] SRR3207864 file size 16797712 SRR3207864 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207864 SRR3207864_1.fastq Input file: SRR3207864_1.fastq trimmed: SRR3207864-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:42:33 2025 >> started Tue Feb 11 10:43:05 2025 >> done (32.148s) 64457865 reads processed; of these: 8585 ( 0.01%) short reads filtered out after trimming by size control 23433 ( 0.04%) empty reads filtered out after trimming by size control 64425847 (99.95%) reads available; of these: 3663898 ( 5.69%) trimmed reads available after processing 60761949 (94.31%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1489 0.00% 19 1927 0.00% 20 2221 0.00% 21 3074 0.00% 22 4337 0.01% 23 6069 0.01% 24 7768 0.01% 25 9441 0.01% 26 9588 0.01% 27 9646 0.01% 28 9896 0.02% 29 10239 0.02% 30 11002 0.02% 31 11195 0.02% 32 11988 0.02% 33 11756 0.02% 34 12827 0.02% 35 12894 0.02% 36 13324 0.02% 37 13841 0.02% 38 13776 0.02% 39 14357 0.02% 40 15289 0.02% 41 17120 0.03% 42 16928 0.03% 43 16867 0.03% 44 17289 0.03% 45 18391 0.03% 46 18964 0.03% 47 19249 0.03% 48 18475 0.03% 49 18084 0.03% 50 18395 0.03% 51 18384 0.03% 52 19080 0.03% 53 20852 0.03% 54 21682 0.03% 55 22054 0.03% 56 23513 0.04% 57 27639 0.04% 58 26924 0.04% 59 26290 0.04% 60 26318 0.04% 61 26776 0.04% 62 27376 0.04% 63 27664 0.04% 64 28174 0.04% 65 28783 0.04% 66 31559 0.05% 67 30458 0.05% 68 32179 0.05% 69 32453 0.05% 70 34444 0.05% 71 36071 0.06% 72 37363 0.06% 73 39264 0.06% 74 40470 0.06% 75 41309 0.06% 76 23942 0.04% 77 27974 0.04% 78 33358 0.05% 79 37422 0.06% 80 39486 0.06% 81 42680 0.07% 82 46341 0.07% 83 50062 0.08% 84 52000 0.08% 85 55136 0.09% 86 58095 0.09% 87 64253 0.10% 88 70172 0.11% 89 77414 0.12% 90 85108 0.13% 91 95035 0.15% 92 108838 0.17% 93 126741 0.20% 94 148877 0.23% 95 177536 0.28% 96 214858 0.33% 97 253798 0.39% 98 304200 0.47% 99 345787 0.54% 100 60761949 94.31% 64425847 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=78.23 fanout-score-rank=6 prefix-density=0.59 prefix-fanout=39.0 sequence=AGATCGGAAGAGCACACGTCTGAACT criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=194.18 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=24.5 sequence=AAGAAGAAGAAA Started job on | Feb 11 10:43:23 Started mapping on | Feb 11 10:43:23 Finished on | Feb 11 10:44:12 Mapping speed, Million of reads per hour | 4733.33 Number of input reads | 64425847 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 62039547 Uniquely mapped reads % | 96.30% Average mapped length | 98.57 Number of splices: Total | 17679285 Number of splices: Annotated (sjdb) | 17344865 Number of splices: GT/AG | 17404237 Number of splices: GC/AG | 224875 Number of splices: AT/AC | 18135 Number of splices: Non-canonical | 32038 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.93 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1477064 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 578003 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 909236 909236 909236 N_multimapping 1477064 1477064 1477064 N_noFeature 2659723 31962910 32308457 N_ambiguous 642440 107857 107795 UnstrandedReadsAssigned:58737384 PositiveStrandReadsAssigned:29968780 NegativeStrandReadsAssigned:29623295 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207864 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207864-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 64,425,847 reads, 60,394,669 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR3207864.ke.tsv 34699 SRR3207864.se.tsv 87100 total ==> SRR3207864.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2714 34.1967 Potri.005G024800.1.v4.1 1035 936 408 10.5398 Potri.004G059700.1.v4.1 961 862 81 2.2721 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1116.64 9.49362 Potri.016G087400.1.v4.1 270 171 2592 366.512 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 283 4.08771 Potri.012G127500.1.v4.1 977 878 11502 316.758 ==> SRR3207864.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 5850 Potri.001G233950.v4.1 7 Potri.001G122700.v4.1 1285 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207864 completed mapping pipeline successfully