Starting /dee2/code/volunteer_pipeline.sh SRR3207865 current disk space = 3053519843328 free memory = 1580082604 SRR3207865 SRAfilesize 00856e3f30939a29292e2d5d2efbc392 SRR3207865.sra SRR3207865.sra file validated SRR3207865 is single end SRR3207865 is conventional basespace SRR3207865 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207865_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.484 34.0 31.0 34.0 31.0 34.0 2 32.337 34.0 31.0 34.0 31.0 34.0 3 32.94075 34.0 33.0 34.0 31.0 34.0 4 36.42025 37.0 37.0 37.0 35.0 37.0 5 36.36625 37.0 37.0 37.0 35.0 37.0 6 36.383 37.0 37.0 37.0 35.0 37.0 7 36.42425 37.0 37.0 37.0 35.0 37.0 8 36.34925 37.0 37.0 37.0 35.0 37.0 9 38.06 39.0 39.0 39.0 37.0 39.0 10-11 38.20875 39.0 39.0 39.0 37.0 39.0 12-13 38.17975 39.0 39.0 39.0 37.0 39.0 14-15 39.7855 41.0 40.0 41.0 37.5 41.0 16-17 39.757374999999996 41.0 40.0 41.0 37.5 41.0 18-19 39.683125000000004 41.0 40.0 41.0 37.0 41.0 20-21 39.645375 41.0 40.0 41.0 37.0 41.0 22-23 39.612125 41.0 40.0 41.0 37.0 41.0 24-25 39.5525 41.0 40.0 41.0 37.0 41.0 26-27 39.2955 41.0 39.5 41.0 36.5 41.0 28-29 39.275875 41.0 39.0 41.0 36.0 41.0 30-31 39.257875 40.0 39.0 41.0 36.0 41.0 32-33 39.206875 40.0 39.0 41.0 36.0 41.0 34-35 39.01375 40.0 38.5 41.0 36.0 41.0 36-37 38.918125 40.0 38.0 41.0 35.0 41.0 38-39 38.788875000000004 40.0 38.0 41.0 35.0 41.0 40-41 38.732875 40.0 38.0 41.0 35.0 41.0 42-43 38.67375 40.0 38.0 41.0 35.0 41.0 44-45 38.670500000000004 40.0 38.0 41.0 35.0 41.0 46-47 38.370625000000004 40.0 38.0 41.0 33.5 41.0 48-49 38.29925 40.0 38.0 41.0 34.0 41.0 50-51 38.338 40.0 38.0 41.0 33.5 41.0 52-53 38.48375 40.0 38.0 41.0 34.5 41.0 54-55 38.45625 40.0 38.0 41.0 34.0 41.0 56-57 38.43375 40.0 38.0 41.0 34.0 41.0 58-59 38.242125 40.0 37.5 41.0 34.0 41.0 60-61 38.047 40.0 37.0 41.0 34.0 41.0 62-63 37.84375 40.0 37.0 41.0 33.5 41.0 64-65 37.429875 39.0 36.0 41.0 33.0 41.0 66-67 37.092625 39.0 36.0 41.0 33.0 41.0 68-69 36.734625 38.5 35.0 40.0 33.0 41.0 70-71 36.308625 37.0 35.0 39.5 32.0 41.0 72-73 35.713125 37.0 35.0 39.0 31.0 41.0 74-75 35.191375 36.0 35.0 39.0 31.0 40.0 76-77 33.70575 35.0 33.0 36.5 28.5 39.0 78-79 34.2685 35.0 34.0 37.0 30.5 39.0 80-81 34.087125 35.0 34.0 36.5 30.5 38.0 82-83 33.825625 35.0 34.0 36.0 30.5 37.0 84-85 33.533 35.0 34.0 36.0 30.0 37.0 86-87 33.35925 35.0 34.0 35.5 30.0 36.5 88-89 33.090625 35.0 34.0 35.0 29.5 36.0 90-91 32.931 35.0 34.0 35.0 29.0 36.0 92-93 32.854875 35.0 34.0 35.0 29.0 36.0 94-95 32.47725 35.0 33.5 35.0 29.0 35.0 96-97 32.357 35.0 34.0 35.0 29.0 35.0 98-99 32.294375 35.0 34.0 35.0 29.0 35.0 100 32.07675 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 3.0 11 2.0 12 2.0 13 6.0 14 3.0 15 3.0 16 3.0 17 3.0 18 5.0 19 12.0 20 4.0 21 5.0 22 5.0 23 11.0 24 13.0 25 13.0 26 11.0 27 16.0 28 30.0 29 31.0 30 42.0 31 53.0 32 84.0 33 93.0 34 129.0 35 200.0 36 346.0 37 942.0 38 1565.0 39 362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.42782152230971 14.908136482939632 16.614173228346456 41.0498687664042 2 21.075 23.849999999999998 35.3 19.775000000000002 3 23.5 27.85 25.575 23.075000000000003 4 23.825 35.275 18.95 21.95 5 24.65 35.725 21.125 18.5 6 18.325 39.300000000000004 23.35 19.025 7 16.75 16.650000000000002 46.025 20.575 8 18.275 22.975 30.45 28.299999999999997 9 20.05501375343836 22.95573893473368 31.032758189547387 25.95648912228057 10-11 23.3125 33.125 21.975 21.587500000000002 12-13 20.075000000000003 26.9625 29.625 23.3375 14-15 21.15 28.237499999999997 28.549999999999997 22.0625 16-17 21.925 27.537499999999998 27.537499999999998 23.0 18-19 21.675 29.3375 26.8 22.1875 20-21 22.037499999999998 27.175 27.962500000000002 22.825 22-23 21.525 29.1125 27.375 21.987499999999997 24-25 20.3 28.825 28.7375 22.1375 26-27 21.462500000000002 28.812500000000004 26.3625 23.3625 28-29 21.637500000000003 28.000000000000004 28.487499999999997 21.875 30-31 21.7375 28.225 28.15 21.8875 32-33 22.075 28.9 27.450000000000003 21.575 34-35 21.4125 28.575 28.4125 21.6 36-37 21.825 28.5875 27.787499999999998 21.8 38-39 22.8875 28.287499999999998 27.1125 21.712500000000002 40-41 22.175 28.9875 27.6625 21.175 42-43 22.7375 28.1 27.325 21.837500000000002 44-45 22.45 27.8625 27.537499999999998 22.15 46-47 22.412499999999998 28.1125 27.425 22.05 48-49 21.399073958202976 28.406957827556 27.73119759729696 22.462770616944063 50-51 21.97747183979975 28.3729662077597 27.74718397997497 21.90237797246558 52-53 21.827728466058257 28.42855356919615 27.61595199399925 22.127765970746342 54-55 21.6125 28.475 27.900000000000002 22.0125 56-57 22.825 28.375 27.4125 21.3875 58-59 21.375 28.325 28.212500000000002 22.0875 60-61 21.8625 28.012500000000003 27.4125 22.7125 62-63 22.177772221527693 28.366045755719465 27.50343792974122 21.952744093011624 64-65 22.2125 28.3375 27.5125 21.9375 66-67 22.4875 28.349999999999998 27.6 21.5625 68-69 21.8 29.425 26.875 21.9 70-71 22.3 28.125 27.025 22.55 72-73 21.875 28.3375 28.050000000000004 21.7375 74-75 22.59194395796848 28.371278458844134 27.207905929447087 21.828871653740308 76-77 21.30162703379224 28.28535669586984 28.53566958698373 21.877346683354194 78-79 21.59289822455614 28.232058014503625 27.806951737934483 22.36809202300575 80-81 22.037499999999998 28.549999999999997 27.212500000000002 22.2 82-83 21.9 28.4375 27.962500000000002 21.7 84-85 21.85 28.050000000000004 27.575 22.525000000000002 86-87 22.55 29.262500000000003 27.5625 20.625 88-89 22.3375 28.15 28.0625 21.45 90-91 22.675 27.987499999999997 28.012500000000003 21.325 92-93 22.775000000000002 28.012500000000003 27.8375 21.375 94-95 22.475 28.375 27.5875 21.5625 96-97 22.4875 28.012500000000003 27.9125 21.587500000000002 98-99 22.05827185194448 29.01087907965487 27.210203826434913 21.720645241965737 100 21.3 28.775000000000002 27.700000000000003 22.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.5 25 3.0 26 4.5 27 5.5 28 10.0 29 18.0 30 20.5 31 27.5 32 31.5 33 43.5 34 60.5 35 72.5 36 87.5 37 111.5 38 149.5 39 175.5 40 186.0 41 211.5 42 241.5 43 248.5 44 264.5 45 289.5 46 272.5 47 237.0 48 221.0 49 203.5 50 169.5 51 137.0 52 107.5 53 82.5 54 66.0 55 45.5 56 33.5 57 26.5 58 21.0 59 20.5 60 21.0 61 15.0 62 7.5 63 6.5 64 6.5 65 6.5 66 6.0 67 3.0 68 2.5 69 2.5 70 2.0 71 2.0 72 1.5 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.11249999999999999 50-51 0.125 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0125 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.075 76-77 0.125 78-79 0.025 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0375 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433416 spots for SRR3207865.sra Written 2433416 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra Read 2433408 spots for SRR3207865.sra Written 2433408 spots for SRR3207865.sra SRR ids: ['SRR3207865.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t8lhn7of SRR3207865.sra spots: 48668168 blocks: [[1, 2433408], [2433409, 4866816], [4866817, 7300224], [7300225, 9733632], [9733633, 12167040], [12167041, 14600448], [14600449, 17033856], [17033857, 19467264], [19467265, 21900672], [21900673, 24334080], [24334081, 26767488], [26767489, 29200896], [29200897, 31634304], [31634305, 34067712], [34067713, 36501120], [36501121, 38934528], [38934529, 41367936], [41367937, 43801344], [43801345, 46234752], [46234753, 48668168]] SRR3207865 file size 12680453 SRR3207865 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207865 SRR3207865_1.fastq Input file: SRR3207865_1.fastq trimmed: SRR3207865-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:16:13 2025 >> started Tue Feb 11 10:16:39 2025 >> done (26.277s) 48668168 reads processed; of these: 6465 ( 0.01%) short reads filtered out after trimming by size control 17680 ( 0.04%) empty reads filtered out after trimming by size control 48644023 (99.95%) reads available; of these: 2894249 ( 5.95%) trimmed reads available after processing 45749774 (94.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1192 0.00% 19 1450 0.00% 20 1792 0.00% 21 2399 0.00% 22 3430 0.01% 23 4710 0.01% 24 5999 0.01% 25 7408 0.02% 26 7540 0.02% 27 7442 0.02% 28 7754 0.02% 29 7982 0.02% 30 8565 0.02% 31 8844 0.02% 32 9291 0.02% 33 9391 0.02% 34 9978 0.02% 35 9952 0.02% 36 10532 0.02% 37 10743 0.02% 38 10930 0.02% 39 11619 0.02% 40 11960 0.02% 41 13586 0.03% 42 13539 0.03% 43 13026 0.03% 44 13682 0.03% 45 14271 0.03% 46 14940 0.03% 47 15311 0.03% 48 14746 0.03% 49 14754 0.03% 50 14640 0.03% 51 14737 0.03% 52 15188 0.03% 53 16618 0.03% 54 17163 0.04% 55 17704 0.04% 56 18609 0.04% 57 22114 0.05% 58 21618 0.04% 59 20988 0.04% 60 20946 0.04% 61 21396 0.04% 62 21516 0.04% 63 21592 0.04% 64 22410 0.05% 65 22737 0.05% 66 24547 0.05% 67 24099 0.05% 68 25251 0.05% 69 25701 0.05% 70 27107 0.06% 71 28887 0.06% 72 29331 0.06% 73 31260 0.06% 74 31820 0.07% 75 32893 0.07% 76 19007 0.04% 77 22347 0.05% 78 26676 0.05% 79 29726 0.06% 80 31406 0.06% 81 33724 0.07% 82 36701 0.08% 83 39498 0.08% 84 41062 0.08% 85 42993 0.09% 86 46297 0.10% 87 51105 0.11% 88 55637 0.11% 89 61563 0.13% 90 67418 0.14% 91 75685 0.16% 92 87035 0.18% 93 100369 0.21% 94 117662 0.24% 95 139910 0.29% 96 168999 0.35% 97 199692 0.41% 98 237849 0.49% 99 272258 0.56% 100 45749774 94.05% 48644023 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=62.10 fanout-score-rank=10 prefix-density=0.46 prefix-fanout=34.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=331.46 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=29.9 sequence=TTCTTCTTCTTC Started job on | Feb 11 10:16:57 Started mapping on | Feb 11 10:16:57 Finished on | Feb 11 10:17:40 Mapping speed, Million of reads per hour | 4072.52 Number of input reads | 48644023 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 46605505 Uniquely mapped reads % | 95.81% Average mapped length | 98.53 Number of splices: Total | 13424566 Number of splices: Annotated (sjdb) | 13173974 Number of splices: GT/AG | 13215231 Number of splices: GC/AG | 171797 Number of splices: AT/AC | 13499 Number of splices: Non-canonical | 24039 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1141032 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 618371 % of reads mapped to too many loci | 1.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 897486 897486 897486 N_multimapping 1141032 1141032 1141032 N_noFeature 2059026 24088314 24275827 N_ambiguous 464519 82391 82557 UnstrandedReadsAssigned:44081960 PositiveStrandReadsAssigned:22434800 NegativeStrandReadsAssigned:22247121 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207865 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207865-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,644,023 reads, 45,511,844 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR3207865.ke.tsv 34699 SRR3207865.se.tsv 87100 total ==> SRR3207865.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2005 33.8761 Potri.005G024800.1.v4.1 1035 936 365 12.6436 Potri.004G059700.1.v4.1 961 862 47 1.76785 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 854.378 9.74034 Potri.016G087400.1.v4.1 270 171 1826.04 346.232 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 222 4.29983 Potri.012G127500.1.v4.1 977 878 9898 365.516 ==> SRR3207865.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4535 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 921 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR3207865 completed mapping pipeline successfully