Starting /dee2/code/volunteer_pipeline.sh SRR3207866 current disk space = 3052971790336 free memory = 1568547216 SRR3207866 SRAfilesize 86f10d5649469f18ca2f9455774391b9 SRR3207866.sra SRR3207866.sra file validated SRR3207866 is single end SRR3207866 is conventional basespace SRR3207866 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207866_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.492 34.0 31.0 34.0 31.0 34.0 2 32.86575 34.0 33.0 34.0 31.0 34.0 3 33.16 34.0 34.0 34.0 31.0 34.0 4 36.55625 37.0 37.0 37.0 35.0 37.0 5 36.48775 37.0 37.0 37.0 35.0 37.0 6 36.483 37.0 37.0 37.0 35.0 37.0 7 36.426 37.0 37.0 37.0 35.0 37.0 8 36.39325 37.0 37.0 37.0 35.0 37.0 9 37.995 39.0 39.0 39.0 35.0 39.0 10-11 38.2495 39.0 39.0 39.0 37.0 39.0 12-13 38.22125 39.0 39.0 39.0 37.0 39.0 14-15 39.83025 41.0 40.0 41.0 38.0 41.0 16-17 39.784125 41.0 40.0 41.0 38.0 41.0 18-19 39.746 41.0 40.0 41.0 37.0 41.0 20-21 39.616 41.0 40.0 41.0 37.0 41.0 22-23 39.604124999999996 41.0 40.0 41.0 37.0 41.0 24-25 39.567375 41.0 40.0 41.0 37.0 41.0 26-27 39.30175 41.0 39.5 41.0 36.5 41.0 28-29 39.36450000000001 41.0 39.0 41.0 37.0 41.0 30-31 39.267875000000004 41.0 39.0 41.0 36.0 41.0 32-33 39.1455 40.0 39.0 41.0 36.0 41.0 34-35 38.949124999999995 40.0 39.0 41.0 36.0 41.0 36-37 38.92525 40.0 38.0 41.0 35.0 41.0 38-39 38.692 40.0 38.0 41.0 35.0 41.0 40-41 38.727125 40.0 38.0 41.0 35.0 41.0 42-43 38.670500000000004 40.0 38.0 41.0 35.0 41.0 44-45 38.666 40.0 38.0 41.0 35.0 41.0 46-47 38.3275 40.0 38.0 41.0 33.5 41.0 48-49 38.283500000000004 40.0 38.0 41.0 34.0 41.0 50-51 38.42075 40.0 38.0 41.0 34.5 41.0 52-53 38.51575 40.0 38.0 41.0 34.0 41.0 54-55 38.508625 40.0 38.0 41.0 35.0 41.0 56-57 38.37 40.0 38.0 41.0 34.0 41.0 58-59 38.063625 40.0 37.5 41.0 34.0 41.0 60-61 37.8945 40.0 37.0 41.0 34.0 41.0 62-63 37.657375 39.5 37.0 41.0 33.5 41.0 64-65 37.294624999999996 39.0 36.0 41.0 33.0 41.0 66-67 36.944375 39.0 35.5 41.0 32.5 41.0 68-69 36.58575 38.0 35.0 40.0 32.0 41.0 70-71 36.149249999999995 37.0 35.0 39.5 32.0 41.0 72-73 35.593999999999994 37.0 35.0 39.0 31.0 41.0 74-75 35.09825 36.0 35.0 39.0 31.0 40.0 76-77 33.655625 35.0 33.0 36.5 29.0 39.0 78-79 34.25975 35.0 34.0 37.0 30.0 39.0 80-81 34.017875000000004 35.0 34.0 36.5 30.5 38.0 82-83 33.7555 35.0 34.0 36.0 30.0 37.0 84-85 33.401125 35.0 34.0 36.0 30.0 37.0 86-87 33.207499999999996 35.0 34.0 35.5 30.0 36.5 88-89 32.959125 35.0 34.0 35.0 29.5 36.0 90-91 32.8405 35.0 34.0 35.0 29.5 36.0 92-93 32.7045 35.0 34.0 35.0 29.5 36.0 94-95 32.54975 35.0 34.0 35.0 29.0 35.5 96-97 32.330375000000004 35.0 34.0 35.0 29.0 35.0 98-99 32.1695 35.0 34.0 35.0 29.0 35.0 100 31.94375 35.0 34.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 4.0 11 1.0 12 2.0 13 5.0 14 6.0 15 6.0 16 9.0 17 2.0 18 6.0 19 4.0 20 9.0 21 6.0 22 9.0 23 16.0 24 9.0 25 17.0 26 10.0 27 17.0 28 25.0 29 33.0 30 41.0 31 47.0 32 63.0 33 86.0 34 131.0 35 194.0 36 363.0 37 933.0 38 1588.0 39 354.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.940040650406505 15.193089430894307 16.84451219512195 42.02235772357724 2 17.775 24.55 38.324999999999996 19.35 3 21.65 27.3 28.299999999999997 22.75 4 23.65 31.65 20.599999999999998 24.099999999999998 5 23.575 34.699999999999996 23.65 18.075 6 18.625 35.925000000000004 25.45 20.0 7 17.599999999999998 16.7 45.0 20.7 8 19.45 22.675 29.4 28.475 9 21.075 22.175 31.674999999999997 25.074999999999996 10-11 22.55 33.3375 23.2375 20.875 12-13 21.087500000000002 25.6125 29.037499999999998 24.2625 14-15 20.4125 27.6625 29.312500000000004 22.6125 16-17 22.162499999999998 28.512500000000003 27.8375 21.4875 18-19 22.1 28.4375 27.525 21.9375 20-21 22.0125 28.025 27.925 22.037499999999998 22-23 21.337500000000002 29.2 26.937499999999996 22.525000000000002 24-25 21.6 29.1625 27.250000000000004 21.987499999999997 26-27 21.8875 28.0625 28.15 21.9 28-29 22.475 28.325 27.0625 22.1375 30-31 22.4625 28.512500000000003 27.125 21.9 32-33 21.8125 28.325 27.150000000000002 22.7125 34-35 21.1625 28.575 28.249999999999996 22.0125 36-37 22.375 27.6125 27.487499999999997 22.525000000000002 38-39 22.412499999999998 27.787499999999998 27.750000000000004 22.05 40-41 21.15 28.3875 29.012500000000003 21.45 42-43 21.2375 28.6375 27.625 22.5 44-45 22.125 28.549999999999997 28.1 21.224999999999998 46-47 21.575 28.1625 27.474999999999998 22.787499999999998 48-49 22.190273784223027 28.2410301287661 27.51593949243655 22.052756594574323 50-51 21.5625 27.9125 28.237499999999997 22.287499999999998 52-53 21.65 28.037499999999998 28.249999999999996 22.0625 54-55 22.0125 27.8375 28.000000000000004 22.15 56-57 22.6375 28.575 27.537499999999998 21.25 58-59 22.0125 27.700000000000003 28.7 21.587500000000002 60-61 22.325 27.8875 28.1625 21.625 62-63 21.575 29.025000000000002 27.6 21.8 64-65 22.412499999999998 27.775 27.224999999999998 22.5875 66-67 22.3125 27.750000000000004 27.725 22.2125 68-69 22.225 28.6375 27.6625 21.475 70-71 21.125 28.65 27.975 22.25 72-73 22.037499999999998 28.0875 27.712500000000002 22.162499999999998 74-75 22.2125 27.787499999999998 27.9375 22.0625 76-77 21.517879469867466 28.469617404351087 27.7569392348087 22.255563890972745 78-79 21.825 28.625 27.725 21.825 80-81 21.5375 28.3125 28.849999999999998 21.3 82-83 21.4 27.725 29.025000000000002 21.85 84-85 21.75 28.475 28.125 21.65 86-87 21.912499999999998 28.475 27.400000000000002 22.2125 88-89 21.212500000000002 28.7 28.6125 21.475 90-91 21.912499999999998 27.5875 28.15 22.35 92-93 22.15 28.9 28.299999999999997 20.65 94-95 21.912499999999998 27.925 28.1875 21.975 96-97 21.625 27.8875 28.787499999999998 21.7 98-99 22.025 27.9125 28.175 21.8875 100 21.55 28.1 27.975 22.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 5.5 27 9.0 28 9.0 29 15.5 30 25.5 31 31.5 32 41.0 33 52.0 34 62.0 35 79.0 36 99.0 37 127.0 38 139.0 39 152.0 40 194.0 41 215.0 42 221.0 43 236.5 44 252.0 45 270.5 46 285.0 47 268.5 48 219.5 49 179.0 50 167.0 51 145.0 52 112.5 53 90.0 54 65.5 55 44.0 56 35.5 57 32.0 58 23.5 59 17.5 60 16.5 61 10.0 62 7.0 63 8.0 64 6.5 65 4.5 66 2.0 67 2.0 68 2.0 69 0.5 70 2.0 71 2.5 72 0.5 73 2.0 74 2.0 75 1.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.11249999999999999 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633490 spots for SRR3207866.sra Written 633490 spots for SRR3207866.sra Read 633504 spots for SRR3207866.sra Written 633504 spots for SRR3207866.sra SRR ids: ['SRR3207866.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uq7gmusz SRR3207866.sra spots: 12669814 blocks: [[1, 633490], [633491, 1266980], [1266981, 1900470], [1900471, 2533960], [2533961, 3167450], [3167451, 3800940], [3800941, 4434430], [4434431, 5067920], [5067921, 5701410], [5701411, 6334900], [6334901, 6968390], [6968391, 7601880], [7601881, 8235370], [8235371, 8868860], [8868861, 9502350], [9502351, 10135840], [10135841, 10769330], [10769331, 11402820], [11402821, 12036310], [12036311, 12669814]] SRR3207866 file size 3293075 SRR3207866 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207866 SRR3207866_1.fastq Input file: SRR3207866_1.fastq trimmed: SRR3207866-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:39:04 2025 >> started Tue Feb 11 10:39:13 2025 >> done (9.369s) 12669814 reads processed; of these: 1524 ( 0.01%) short reads filtered out after trimming by size control 4929 ( 0.04%) empty reads filtered out after trimming by size control 12663361 (99.95%) reads available; of these: 727820 ( 5.75%) trimmed reads available after processing 11935541 (94.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 297 0.00% 19 380 0.00% 20 425 0.00% 21 597 0.00% 22 817 0.01% 23 1225 0.01% 24 1528 0.01% 25 1888 0.01% 26 1829 0.01% 27 1859 0.01% 28 2069 0.02% 29 2004 0.02% 30 2199 0.02% 31 2193 0.02% 32 2351 0.02% 33 2338 0.02% 34 2483 0.02% 35 2509 0.02% 36 2497 0.02% 37 2690 0.02% 38 2818 0.02% 39 2827 0.02% 40 2922 0.02% 41 3315 0.03% 42 3296 0.03% 43 3268 0.03% 44 3424 0.03% 45 3673 0.03% 46 3749 0.03% 47 3843 0.03% 48 3766 0.03% 49 3703 0.03% 50 3529 0.03% 51 3688 0.03% 52 3808 0.03% 53 4161 0.03% 54 4333 0.03% 55 4366 0.03% 56 4645 0.04% 57 5606 0.04% 58 5411 0.04% 59 5227 0.04% 60 5298 0.04% 61 5261 0.04% 62 5404 0.04% 63 5564 0.04% 64 5528 0.04% 65 5778 0.05% 66 6145 0.05% 67 5900 0.05% 68 6382 0.05% 69 6365 0.05% 70 6749 0.05% 71 7176 0.06% 72 7388 0.06% 73 7712 0.06% 74 7920 0.06% 75 8352 0.07% 76 4852 0.04% 77 5709 0.05% 78 6608 0.05% 79 7447 0.06% 80 7799 0.06% 81 8502 0.07% 82 9238 0.07% 83 10137 0.08% 84 10220 0.08% 85 11116 0.09% 86 11380 0.09% 87 13016 0.10% 88 13851 0.11% 89 15474 0.12% 90 16983 0.13% 91 18971 0.15% 92 21942 0.17% 93 25145 0.20% 94 29605 0.23% 95 35062 0.28% 96 42611 0.34% 97 50194 0.40% 98 60427 0.48% 99 69053 0.55% 100 11935541 94.25% 12663361 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=56.16 fanout-score-rank=10 prefix-density=0.28 prefix-fanout=28.9 sequence=AGATCGGAAGAGCACACGTCTGAACTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=252.70 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=26.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 10:39:29 Started mapping on | Feb 11 10:39:29 Finished on | Feb 11 10:39:43 Mapping speed, Million of reads per hour | 3256.29 Number of input reads | 12663361 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 12183509 Uniquely mapped reads % | 96.21% Average mapped length | 98.63 Number of splices: Total | 3377697 Number of splices: Annotated (sjdb) | 3311636 Number of splices: GT/AG | 3324859 Number of splices: GC/AG | 43237 Number of splices: AT/AC | 3522 Number of splices: Non-canonical | 6079 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.97 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286141 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 127325 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 193711 193711 193711 N_multimapping 286141 286141 286141 N_noFeature 537852 6268776 6358926 N_ambiguous 136814 21873 21527 UnstrandedReadsAssigned:11508843 PositiveStrandReadsAssigned:5892860 NegativeStrandReadsAssigned:5803056 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207866 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207866-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,663,361 reads, 11,852,658 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52401 SRR3207866.ke.tsv 34699 SRR3207866.se.tsv 87100 total ==> SRR3207866.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 454 28.7631 Potri.005G024800.1.v4.1 1035 936 82 10.651 Potri.004G059700.1.v4.1 961 862 14 1.97458 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 214.324 9.1621 Potri.016G087400.1.v4.1 270 171 476 338.427 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 64 4.64814 Potri.012G127500.1.v4.1 977 878 2085 288.713 ==> SRR3207866.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1302 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207866 completed mapping pipeline successfully