Starting /dee2/code/volunteer_pipeline.sh SRR3207867 current disk space = 3054216970240 free memory = 1481228708 SRR3207867 SRAfilesize b97e2c2b9a31c99d17a2f549a11e71d0 SRR3207867.sra SRR3207867.sra file validated SRR3207867 is single end SRR3207867 is conventional basespace SRR3207867 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207867_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.776 34.0 33.0 34.0 31.0 34.0 2 33.055 34.0 33.0 34.0 31.0 34.0 3 33.2195 34.0 34.0 34.0 31.0 34.0 4 36.552 37.0 37.0 37.0 35.0 37.0 5 36.494 37.0 37.0 37.0 35.0 37.0 6 36.47875 37.0 37.0 37.0 35.0 37.0 7 36.44525 37.0 37.0 37.0 35.0 37.0 8 36.45225 37.0 37.0 37.0 35.0 37.0 9 38.1105 39.0 39.0 39.0 37.0 39.0 10-11 38.281375 39.0 39.0 39.0 37.0 39.0 12-13 38.213499999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.845749999999995 41.0 40.0 41.0 38.0 41.0 16-17 39.816125 41.0 40.0 41.0 37.5 41.0 18-19 39.80275 41.0 40.0 41.0 37.5 41.0 20-21 39.662 41.0 40.0 41.0 37.5 41.0 22-23 39.667500000000004 41.0 40.0 41.0 37.0 41.0 24-25 39.67675 41.0 40.0 41.0 37.0 41.0 26-27 39.37325 41.0 39.5 41.0 36.5 41.0 28-29 39.383250000000004 41.0 39.0 41.0 37.0 41.0 30-31 39.3465 40.5 39.0 41.0 36.5 41.0 32-33 39.26275 40.5 39.0 41.0 36.0 41.0 34-35 39.004999999999995 40.0 39.0 41.0 36.0 41.0 36-37 38.9555 40.0 39.0 41.0 35.5 41.0 38-39 38.690125 40.0 38.0 41.0 35.0 41.0 40-41 38.814375 40.0 38.0 41.0 35.0 41.0 42-43 38.704375 40.0 38.0 41.0 35.0 41.0 44-45 38.745125 40.0 38.0 41.0 35.0 41.0 46-47 38.380250000000004 40.0 38.0 41.0 34.5 41.0 48-49 38.278625000000005 40.0 38.0 41.0 34.0 41.0 50-51 38.412875 40.0 38.0 41.0 34.0 41.0 52-53 38.623125 40.0 38.5 41.0 34.5 41.0 54-55 38.587999999999994 40.0 38.0 41.0 35.0 41.0 56-57 38.485875 40.0 38.0 41.0 35.0 41.0 58-59 38.19525 40.0 38.0 41.0 34.0 41.0 60-61 38.043125 40.0 37.0 41.0 34.0 41.0 62-63 37.81425 40.0 37.0 41.0 34.0 41.0 64-65 37.406875 39.0 36.0 41.0 33.0 41.0 66-67 37.12675 39.0 36.0 41.0 33.0 41.0 68-69 36.719375 38.5 35.0 40.0 32.0 41.0 70-71 36.361 37.0 35.0 39.5 33.0 41.0 72-73 35.79925 37.0 35.0 39.0 32.0 41.0 74-75 35.36625 36.0 35.0 39.0 31.0 40.0 76-77 33.818125 35.0 33.0 37.0 29.5 39.0 78-79 34.35725 35.0 34.0 37.0 30.5 39.0 80-81 34.142875000000004 35.0 34.0 36.5 30.5 38.0 82-83 33.855875 35.0 34.0 36.0 31.0 37.0 84-85 33.584 35.0 34.0 36.0 30.0 37.0 86-87 33.35 35.0 34.0 35.5 30.0 36.5 88-89 33.145875000000004 35.0 34.0 35.0 30.0 36.0 90-91 32.949375 35.0 34.0 35.0 29.5 36.0 92-93 32.837875 35.0 34.0 35.0 29.5 36.0 94-95 32.684 35.0 34.0 35.0 29.0 35.0 96-97 32.389624999999995 35.0 34.0 35.0 29.0 35.0 98-99 32.306625 35.0 34.0 35.0 29.0 35.0 100 32.13775 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 3.0 10 3.0 11 1.0 12 6.0 13 4.0 14 3.0 15 1.0 16 5.0 17 10.0 18 7.0 19 3.0 20 3.0 21 5.0 22 10.0 23 6.0 24 13.0 25 11.0 26 20.0 27 18.0 28 25.0 29 30.0 30 31.0 31 50.0 32 74.0 33 71.0 34 109.0 35 198.0 36 357.0 37 908.0 38 1653.0 39 361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.149231157045627 15.250819258885809 15.956642298966472 44.64330728510209 2 19.1 23.549999999999997 37.925 19.425 3 21.375 28.025 26.25 24.349999999999998 4 23.95 32.824999999999996 20.45 22.775000000000002 5 24.875 36.5 19.950000000000003 18.675 6 17.825 38.9 24.099999999999998 19.175 7 17.375 17.875 45.275 19.475 8 18.65 22.625 30.275000000000002 28.449999999999996 9 21.025 21.4 32.525 25.05 10-11 22.325 33.475 22.25 21.95 12-13 19.975 26.5625 29.8375 23.625 14-15 21.6125 28.025 28.15 22.2125 16-17 22.05 27.450000000000003 27.025 23.474999999999998 18-19 21.7875 27.800000000000004 28.0625 22.35 20-21 22.725 28.1625 27.425 21.6875 22-23 21.587500000000002 28.325 27.800000000000004 22.287499999999998 24-25 21.725 28.325 27.525 22.425 26-27 22.2 28.175 26.900000000000002 22.725 28-29 21.725 28.449999999999996 27.5625 22.2625 30-31 20.424999999999997 28.3375 27.675 23.5625 32-33 21.55 29.0875 27.762500000000003 21.6 34-35 22.05 28.749999999999996 26.8125 22.3875 36-37 20.75 28.675 27.6125 22.9625 38-39 22.2 27.875 27.6875 22.237499999999997 40-41 22.05 28.325 27.3625 22.2625 42-43 22.4375 28.0625 27.212500000000002 22.287499999999998 44-45 21.175 28.875 27.537499999999998 22.412499999999998 46-47 22.1375 27.500000000000004 27.925 22.4375 48-49 21.56347717323327 28.2801751094434 28.142589118198874 22.013758599124454 50-51 22.25140712945591 27.229518449030643 27.517198248905565 23.00187617260788 52-53 21.1375 29.312500000000004 27.950000000000003 21.6 54-55 22.575 27.275 27.500000000000004 22.650000000000002 56-57 21.575 27.787499999999998 28.3875 22.25 58-59 22.287499999999998 28.575 27.5125 21.625 60-61 21.4875 28.762500000000003 27.6125 22.1375 62-63 21.8 28.512500000000003 28.025 21.6625 64-65 22.2625 27.8625 28.3625 21.512500000000003 66-67 22.175 27.425 28.8625 21.5375 68-69 21.725 28.462500000000002 27.787499999999998 22.025 70-71 21.5625 28.425 28.462500000000002 21.55 72-73 21.45 28.775000000000002 27.9375 21.837500000000002 74-75 21.640205025628205 28.84110513814227 27.378422302787847 22.14026753344168 76-77 21.999749718433236 27.4183456388437 28.256788887498434 22.32511575522463 78-79 21.925 28.050000000000004 28.175 21.85 80-81 23.1625 27.6625 27.1625 22.0125 82-83 22.0875 28.1125 27.8125 21.987499999999997 84-85 21.975 27.85 28.000000000000004 22.175 86-87 21.625 28.050000000000004 27.975 22.35 88-89 22.0 28.449999999999996 28.050000000000004 21.5 90-91 22.112499999999997 28.4125 27.775 21.7 92-93 22.6125 28.512500000000003 27.8375 21.0375 94-95 22.475 28.775000000000002 27.3125 21.4375 96-97 22.7 28.95 27.675 20.674999999999997 98-99 22.537499999999998 28.075 27.525 21.8625 100 22.725 27.6 27.950000000000003 21.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 1.0 25 0.5 26 2.5 27 3.5 28 5.0 29 8.5 30 16.5 31 27.0 32 37.5 33 47.0 34 56.5 35 78.0 36 87.5 37 100.5 38 131.5 39 158.0 40 188.0 41 221.5 42 250.5 43 266.0 44 283.0 45 283.5 46 271.5 47 251.0 48 224.5 49 197.0 50 176.5 51 159.0 52 112.5 53 83.0 54 70.5 55 46.0 56 26.0 57 26.0 58 26.0 59 15.5 60 9.0 61 7.0 62 4.0 63 3.0 64 4.0 65 4.5 66 5.0 67 2.0 68 1.5 69 2.5 70 1.5 71 1.5 72 2.0 73 1.5 74 0.5 75 0.5 76 1.5 77 1.0 78 0.5 79 1.0 80 0.5 81 0.0 82 1.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0625 50-51 0.0625 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.11249999999999999 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464164 spots for SRR3207867.sra Written 464164 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra Read 464163 spots for SRR3207867.sra Written 464163 spots for SRR3207867.sra SRR ids: ['SRR3207867.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0wwfaxb9 SRR3207867.sra spots: 9283261 blocks: [[1, 464163], [464164, 928326], [928327, 1392489], [1392490, 1856652], [1856653, 2320815], [2320816, 2784978], [2784979, 3249141], [3249142, 3713304], [3713305, 4177467], [4177468, 4641630], [4641631, 5105793], [5105794, 5569956], [5569957, 6034119], [6034120, 6498282], [6498283, 6962445], [6962446, 7426608], [7426609, 7890771], [7890772, 8354934], [8354935, 8819097], [8819098, 9283261]] SRR3207867 file size 2410650 SRR3207867 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207867 SRR3207867_1.fastq Input file: SRR3207867_1.fastq trimmed: SRR3207867-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:51:58 2025 >> started Tue Feb 11 09:52:02 2025 >> done (4.580s) 9283261 reads processed; of these: 1432 ( 0.02%) short reads filtered out after trimming by size control 3028 ( 0.03%) empty reads filtered out after trimming by size control 9278801 (99.95%) reads available; of these: 539510 ( 5.81%) trimmed reads available after processing 8739291 (94.19%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 233 0.00% 19 276 0.00% 20 326 0.00% 21 412 0.00% 22 632 0.01% 23 890 0.01% 24 1130 0.01% 25 1419 0.02% 26 1433 0.02% 27 1405 0.02% 28 1491 0.02% 29 1485 0.02% 30 1564 0.02% 31 1636 0.02% 32 1784 0.02% 33 1739 0.02% 34 1826 0.02% 35 1896 0.02% 36 1953 0.02% 37 1987 0.02% 38 2112 0.02% 39 2165 0.02% 40 2873 0.03% 41 2520 0.03% 42 2433 0.03% 43 2450 0.03% 44 2556 0.03% 45 2764 0.03% 46 2771 0.03% 47 2887 0.03% 48 2772 0.03% 49 2748 0.03% 50 2649 0.03% 51 2756 0.03% 52 2845 0.03% 53 3009 0.03% 54 3232 0.03% 55 3232 0.03% 56 3414 0.04% 57 4150 0.04% 58 4800 0.05% 59 3956 0.04% 60 3829 0.04% 61 4038 0.04% 62 3981 0.04% 63 4015 0.04% 64 4094 0.04% 65 4328 0.05% 66 4493 0.05% 67 4449 0.05% 68 4806 0.05% 69 4814 0.05% 70 5176 0.06% 71 5302 0.06% 72 5398 0.06% 73 5739 0.06% 74 5886 0.06% 75 6201 0.07% 76 3548 0.04% 77 4038 0.04% 78 5036 0.05% 79 5474 0.06% 80 5762 0.06% 81 6372 0.07% 82 6767 0.07% 83 7325 0.08% 84 7631 0.08% 85 8091 0.09% 86 8589 0.09% 87 9412 0.10% 88 10505 0.11% 89 11321 0.12% 90 12452 0.13% 91 14037 0.15% 92 15926 0.17% 93 18542 0.20% 94 21779 0.23% 95 26071 0.28% 96 31490 0.34% 97 37304 0.40% 98 44278 0.48% 99 50600 0.55% 100 8739291 94.19% 9278801 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=40.93 fanout-score-rank=6 prefix-density=0.21 prefix-fanout=24.4 sequence=AGATCGGAAGAGCACACGTCTGAACTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=183.41 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=24.3 sequence=AAGAAGAAGAAA Started job on | Feb 11 09:52:20 Started mapping on | Feb 11 09:52:20 Finished on | Feb 11 09:52:30 Mapping speed, Million of reads per hour | 3340.37 Number of input reads | 9278801 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 8903792 Uniquely mapped reads % | 95.96% Average mapped length | 98.62 Number of splices: Total | 2523217 Number of splices: Annotated (sjdb) | 2475524 Number of splices: GT/AG | 2483644 Number of splices: GC/AG | 32418 Number of splices: AT/AC | 2697 Number of splices: Non-canonical | 4458 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 1.91 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 212289 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 114402 % of reads mapped to too many loci | 1.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 162720 162720 162720 N_multimapping 212289 212289 212289 N_noFeature 385698 4577380 4648442 N_ambiguous 94858 15681 15660 UnstrandedReadsAssigned:8423236 PositiveStrandReadsAssigned:4310731 NegativeStrandReadsAssigned:4239690 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207867 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207867-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,278,801 reads, 8,692,869 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR3207867.ke.tsv 34699 SRR3207867.se.tsv 87100 total ==> SRR3207867.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 326 28.286 Potri.005G024800.1.v4.1 1035 936 76 13.5197 Potri.004G059700.1.v4.1 961 862 12 2.31794 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 147.358 8.62727 Potri.016G087400.1.v4.1 270 171 363.516 353.961 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37.4651 3.72649 Potri.012G127500.1.v4.1 977 878 1476 279.911 ==> SRR3207867.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 946 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207867 completed mapping pipeline successfully