Starting /dee2/code/volunteer_pipeline.sh SRR3207868 current disk space = 3054666887168 free memory = 1406883264 SRR3207868 SRAfilesize 185f1d3bb55bae58d9820fdcac4976ec SRR3207868.sra SRR3207868.sra file validated SRR3207868 is single end SRR3207868 is conventional basespace SRR3207868 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207868_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.44775 34.0 31.0 34.0 30.0 34.0 2 32.26975 34.0 31.0 34.0 31.0 34.0 3 32.915 34.0 31.0 34.0 31.0 34.0 4 36.3865 37.0 37.0 37.0 35.0 37.0 5 36.3455 37.0 37.0 37.0 35.0 37.0 6 36.321 37.0 37.0 37.0 35.0 37.0 7 36.34925 37.0 37.0 37.0 35.0 37.0 8 36.3725 37.0 37.0 37.0 35.0 37.0 9 38.255 39.0 39.0 39.0 37.0 39.0 10-11 38.195 39.0 39.0 39.0 37.0 39.0 12-13 38.240750000000006 39.0 39.0 39.0 37.0 39.0 14-15 39.757875 41.0 40.0 41.0 37.5 41.0 16-17 39.729124999999996 41.0 40.0 41.0 37.0 41.0 18-19 39.715 41.0 40.0 41.0 37.5 41.0 20-21 39.635875 41.0 40.0 41.0 37.0 41.0 22-23 39.528125 41.0 40.0 41.0 36.5 41.0 24-25 39.565749999999994 41.0 40.0 41.0 37.0 41.0 26-27 39.37975 41.0 39.0 41.0 37.0 41.0 28-29 39.350875 41.0 39.0 41.0 36.5 41.0 30-31 39.230000000000004 40.0 39.0 41.0 36.0 41.0 32-33 39.032125 40.0 39.0 41.0 36.0 41.0 34-35 38.95375 40.0 38.5 41.0 35.5 41.0 36-37 38.837374999999994 40.0 38.0 41.0 35.5 41.0 38-39 38.6805 40.0 38.0 41.0 35.0 41.0 40-41 38.580124999999995 40.0 38.0 41.0 35.0 41.0 42-43 38.701375 40.0 38.0 41.0 35.0 41.0 44-45 38.672625 40.0 38.0 41.0 35.0 41.0 46-47 38.452 40.0 38.0 41.0 34.5 41.0 48-49 38.237875 40.0 38.0 41.0 33.5 41.0 50-51 38.2285 40.0 38.0 41.0 34.0 41.0 52-53 38.451625 40.0 38.0 41.0 34.5 41.0 54-55 38.420125 40.0 38.0 41.0 34.0 41.0 56-57 38.32225 40.0 38.0 41.0 34.0 41.0 58-59 37.758375 40.0 37.5 41.0 33.5 41.0 60-61 36.705875000000006 40.0 37.0 41.0 31.5 41.0 62-63 36.082125 39.5 36.0 41.0 30.0 41.0 64-65 36.174625 39.0 35.5 41.0 30.0 41.0 66-67 36.376625000000004 39.0 35.0 40.5 31.0 41.0 68-69 36.341125 38.0 35.0 40.0 31.5 41.0 70-71 36.109 37.0 35.0 39.5 32.0 41.0 72-73 35.314375 36.5 35.0 39.0 30.5 40.5 74-75 35.132125 36.0 35.0 39.0 31.0 40.0 76-77 33.583625 35.0 33.0 36.5 29.0 39.0 78-79 34.133625 35.0 34.0 37.0 30.5 39.0 80-81 33.977000000000004 35.0 34.0 36.5 30.5 38.0 82-83 33.744249999999994 35.0 34.0 36.0 30.5 37.0 84-85 33.4075 35.0 34.0 36.0 30.0 37.0 86-87 33.255624999999995 35.0 34.0 35.5 30.0 36.5 88-89 33.00925 35.0 34.0 35.0 29.5 36.0 90-91 32.671625 35.0 34.0 35.0 29.0 36.0 92-93 32.461625 35.0 34.0 35.0 29.0 36.0 94-95 32.254374999999996 35.0 34.0 35.0 29.0 35.5 96-97 31.95075 35.0 33.0 35.0 27.0 35.0 98-99 31.67725 35.0 33.0 35.0 25.5 35.0 100 31.64825 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 2.0 11 6.0 12 6.0 13 3.0 14 4.0 15 4.0 16 5.0 17 8.0 18 11.0 19 8.0 20 9.0 21 6.0 22 12.0 23 9.0 24 11.0 25 9.0 26 18.0 27 13.0 28 30.0 29 30.0 30 38.0 31 50.0 32 75.0 33 111.0 34 184.0 35 226.0 36 391.0 37 885.0 38 1508.0 39 325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.353588266107913 15.112624410686223 16.736511262441066 42.7972760607648 2 20.349999999999998 24.325 35.775 19.55 3 23.275000000000002 27.750000000000004 24.775 24.2 4 25.28132033008252 33.05826456614154 20.38009502375594 21.280320080020005 5 24.224999999999998 35.449999999999996 23.474999999999998 16.85 6 17.549999999999997 37.574999999999996 24.6 20.275000000000002 7 16.1 17.775 46.1 20.025000000000002 8 19.5 24.224999999999998 29.15 27.125 9 21.125 22.55 31.6 24.725 10-11 22.237499999999997 33.7875 22.6125 21.3625 12-13 20.3375 26.337500000000002 30.1375 23.1875 14-15 20.7375 27.975 29.5 21.7875 16-17 22.0125 27.5625 27.6875 22.7375 18-19 21.2375 28.825 27.425 22.5125 20-21 21.512500000000003 28.7 27.925 21.8625 22-23 21.675 28.212500000000002 27.3875 22.725 24-25 21.7875 28.349999999999998 28.262500000000003 21.6 26-27 22.625 27.975 27.975 21.425 28-29 22.375 27.400000000000002 28.3875 21.837500000000002 30-31 21.6125 27.575 28.4 22.412499999999998 32-33 22.625 27.8125 27.474999999999998 22.0875 34-35 21.525 28.4 28.6375 21.4375 36-37 22.3875 28.0625 28.125 21.425 38-39 21.8625 27.437499999999996 28.212500000000002 22.4875 40-41 21.712500000000002 27.962500000000002 27.6875 22.6375 42-43 22.2125 28.199999999999996 27.987499999999997 21.6 44-45 21.875 28.225 28.299999999999997 21.6 46-47 22.115264408051004 27.50343792974122 28.353544193024128 22.027753469183647 48-49 22.426516572858034 28.742964352720453 27.27954971857411 21.550969355847403 50-51 21.885942971485743 28.62681340670335 27.926463231615806 21.5607803901951 52-53 21.90273784223028 28.82860357544693 27.890986373296663 21.377672209026127 54-55 21.099999999999998 27.625 28.5875 22.6875 56-57 22.0625 27.1125 28.262500000000003 22.5625 58-59 22.08891134124779 27.847941399343267 28.05001262945188 22.013134629957058 60-61 21.812774760796483 28.562192914403933 27.47607964830618 22.148952676493405 62-63 22.795362771916114 27.914549954409274 27.70613520906604 21.58395206460857 64-65 21.51044319918492 27.699949057564954 29.062659195109525 21.7269485481406 66-67 21.925 28.425 28.1625 21.4875 68-69 22.025 27.575 28.249999999999996 22.15 70-71 21.512500000000003 28.4 28.249999999999996 21.837500000000002 72-73 21.912499999999998 28.799999999999997 27.875 21.4125 74-75 21.41517689711214 28.678584823102888 27.990998874859358 21.915239404925615 76-77 21.895710891584343 28.010503938977116 27.5728398149306 22.52094535450794 78-79 22.5125 27.875 27.950000000000003 21.6625 80-81 22.2625 28.012500000000003 27.175 22.55 82-83 21.425 28.749999999999996 28.5625 21.2625 84-85 21.637500000000003 28.499999999999996 27.962500000000002 21.9 86-87 22.037499999999998 27.950000000000003 27.787499999999998 22.225 88-89 21.762500000000003 27.375 28.875 21.987499999999997 90-91 21.075 28.225 28.499999999999996 22.2 92-93 22.75 27.9125 27.925 21.4125 94-95 22.8875 27.787499999999998 27.9125 21.4125 96-97 22.625 27.987499999999997 27.55 21.837500000000002 98-99 22.037499999999998 28.7 27.8625 21.4 100 22.475 28.849999999999998 27.675 21.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 2.5 25 3.0 26 4.5 27 10.0 28 9.0 29 10.0 30 20.0 31 26.0 32 37.0 33 48.5 34 54.5 35 78.0 36 101.5 37 114.0 38 147.0 39 184.0 40 199.0 41 222.0 42 250.5 43 252.5 44 263.0 45 269.0 46 256.5 47 261.0 48 238.0 49 190.5 50 158.5 51 127.5 52 100.0 53 86.0 54 66.5 55 46.5 56 37.5 57 27.5 58 18.0 59 15.5 60 13.5 61 9.0 62 6.0 63 3.0 64 2.5 65 3.5 66 3.5 67 3.0 68 3.5 69 3.5 70 1.5 71 1.0 72 1.0 73 1.0 74 1.0 75 0.5 76 0.0 77 1.0 78 1.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.55 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0625 50-51 0.05 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 1.0250000000000001 60-61 3.325 62-63 4.0375000000000005 64-65 1.8499999999999999 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0375 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88 0.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230134 spots for SRR3207868.sra Written 3230134 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra Read 3230122 spots for SRR3207868.sra Written 3230122 spots for SRR3207868.sra SRR ids: ['SRR3207868.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nv4ccpa_ SRR3207868.sra spots: 64602452 blocks: [[1, 3230122], [3230123, 6460244], [6460245, 9690366], [9690367, 12920488], [12920489, 16150610], [16150611, 19380732], [19380733, 22610854], [22610855, 25840976], [25840977, 29071098], [29071099, 32301220], [32301221, 35531342], [35531343, 38761464], [38761465, 41991586], [41991587, 45221708], [45221709, 48451830], [48451831, 51681952], [51681953, 54912074], [54912075, 58142196], [58142197, 61372318], [61372319, 64602452]] SRR3207868 file size 16835346 SRR3207868 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207868 SRR3207868_1.fastq Input file: SRR3207868_1.fastq trimmed: SRR3207868-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 09:42:52 2025 >> started Tue Feb 11 09:43:32 2025 >> done (39.432s) 64602452 reads processed; of these: 8587 ( 0.01%) short reads filtered out after trimming by size control 18089 ( 0.03%) empty reads filtered out after trimming by size control 64575776 (99.96%) reads available; of these: 3985390 ( 6.17%) trimmed reads available after processing 60590386 (93.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1522 0.00% 19 2077 0.00% 20 2360 0.00% 21 3238 0.01% 22 4445 0.01% 23 6327 0.01% 24 8396 0.01% 25 10619 0.02% 26 11466 0.02% 27 11087 0.02% 28 10844 0.02% 29 11011 0.02% 30 11434 0.02% 31 11664 0.02% 32 12075 0.02% 33 12305 0.02% 34 13175 0.02% 35 13768 0.02% 36 13753 0.02% 37 14443 0.02% 38 14631 0.02% 39 15251 0.02% 40 15187 0.02% 41 15798 0.02% 42 16068 0.02% 43 17038 0.03% 44 17386 0.03% 45 18460 0.03% 46 19875 0.03% 47 19450 0.03% 48 19403 0.03% 49 20038 0.03% 50 19456 0.03% 51 19746 0.03% 52 20551 0.03% 53 21700 0.03% 54 22669 0.04% 55 23483 0.04% 56 24404 0.04% 57 24964 0.04% 58 25791 0.04% 59 26842 0.04% 60 27565 0.04% 61 28112 0.04% 62 28969 0.04% 63 28765 0.04% 64 29566 0.05% 65 30506 0.05% 66 34012 0.05% 67 33292 0.05% 68 34053 0.05% 69 34793 0.05% 70 37205 0.06% 71 39350 0.06% 72 41525 0.06% 73 43382 0.07% 74 44307 0.07% 75 46790 0.07% 76 26490 0.04% 77 30731 0.05% 78 37004 0.06% 79 41248 0.06% 80 43752 0.07% 81 47661 0.07% 82 49848 0.08% 83 55576 0.09% 84 57169 0.09% 85 60915 0.09% 86 65158 0.10% 87 71357 0.11% 88 77286 0.12% 89 84305 0.13% 90 93871 0.15% 91 104603 0.16% 92 121104 0.19% 93 138783 0.21% 94 165463 0.26% 95 198270 0.31% 96 240464 0.37% 97 287819 0.45% 98 338355 0.52% 99 361766 0.56% 100 60590386 93.83% 64575776 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=74.06 fanout-score-rank=7 prefix-density=0.76 prefix-fanout=40.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=263.61 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=26.4 sequence=TTCTTCTTCTTT Started job on | Feb 11 09:43:51 Started mapping on | Feb 11 09:43:52 Finished on | Feb 11 09:44:45 Mapping speed, Million of reads per hour | 4386.28 Number of input reads | 64575776 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 61993088 Uniquely mapped reads % | 96.00% Average mapped length | 98.49 Number of splices: Total | 17828982 Number of splices: Annotated (sjdb) | 17488135 Number of splices: GT/AG | 17548102 Number of splices: GC/AG | 230916 Number of splices: AT/AC | 18170 Number of splices: Non-canonical | 31794 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1505707 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 707637 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1076981 1076981 1076981 N_multimapping 1505707 1505707 1505707 N_noFeature 2752351 31976122 32361204 N_ambiguous 621911 106868 108011 UnstrandedReadsAssigned:58618826 PositiveStrandReadsAssigned:29910098 NegativeStrandReadsAssigned:29523873 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207868 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207868-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 64,575,776 reads, 60,387,350 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR3207868.ke.tsv 34699 SRR3207868.se.tsv 87100 total ==> SRR3207868.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2187 27.7097 Potri.005G024800.1.v4.1 1035 936 364 9.45548 Potri.004G059700.1.v4.1 961 862 86 2.42577 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1124.54 9.61402 Potri.016G087400.1.v4.1 270 171 2681.53 381.281 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 322 4.6769 Potri.012G127500.1.v4.1 977 878 11382 315.197 ==> SRR3207868.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6495 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 1311 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 53 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207868 completed mapping pipeline successfully