Starting /dee2/code/volunteer_pipeline.sh SRR3207869 current disk space = 3053287952384 free memory = 1504730528 SRR3207869 SRAfilesize 84312b099210686f5217b74c2f9b02eb SRR3207869.sra SRR3207869.sra file validated SRR3207869 is single end SRR3207869 is conventional basespace SRR3207869 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207869_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54775 34.0 31.0 34.0 31.0 34.0 2 32.86725 34.0 33.0 34.0 31.0 34.0 3 33.0675 34.0 33.0 34.0 31.0 34.0 4 36.4475 37.0 37.0 37.0 35.0 37.0 5 36.42475 37.0 37.0 37.0 35.0 37.0 6 36.40475 37.0 37.0 37.0 35.0 37.0 7 36.3555 37.0 37.0 37.0 35.0 37.0 8 36.4265 37.0 37.0 37.0 35.0 37.0 9 38.323 39.0 39.0 39.0 37.0 39.0 10-11 38.22875 39.0 39.0 39.0 37.0 39.0 12-13 38.223 39.0 39.0 39.0 37.0 39.0 14-15 39.739 41.0 40.0 41.0 37.5 41.0 16-17 39.669875000000005 41.0 40.0 41.0 37.0 41.0 18-19 39.7105 41.0 40.0 41.0 37.0 41.0 20-21 39.611125 41.0 40.0 41.0 37.0 41.0 22-23 39.548500000000004 41.0 40.0 41.0 37.0 41.0 24-25 39.61175 41.0 40.0 41.0 37.0 41.0 26-27 39.4905 41.0 39.5 41.0 37.0 41.0 28-29 39.4165 41.0 39.0 41.0 37.0 41.0 30-31 39.319 41.0 39.0 41.0 36.0 41.0 32-33 39.082875 40.0 39.0 41.0 36.0 41.0 34-35 39.02275 40.0 39.0 41.0 36.0 41.0 36-37 38.803 40.0 38.0 41.0 35.0 41.0 38-39 38.699 40.0 38.0 41.0 35.0 41.0 40-41 38.623125 40.0 38.0 41.0 35.0 41.0 42-43 38.701 40.0 38.0 41.0 35.0 41.0 44-45 38.629999999999995 40.0 38.0 41.0 35.0 41.0 46-47 38.525999999999996 40.0 38.0 41.0 34.0 41.0 48-49 38.314375 40.0 38.0 41.0 34.0 41.0 50-51 38.292 40.0 38.0 41.0 34.0 41.0 52-53 38.493375 40.0 38.0 41.0 34.0 41.0 54-55 38.420249999999996 40.0 38.0 41.0 34.0 41.0 56-57 38.309 40.0 38.0 41.0 34.0 41.0 58-59 37.983000000000004 40.0 37.5 41.0 34.0 41.0 60-61 37.564 40.0 37.0 41.0 33.0 41.0 62-63 37.29375 39.5 36.5 41.0 33.0 41.0 64-65 37.022125 39.0 36.0 41.0 32.5 41.0 66-67 36.794624999999996 39.0 35.5 41.0 32.5 41.0 68-69 36.538250000000005 38.0 35.0 40.0 32.0 41.0 70-71 36.156 37.0 35.0 39.5 32.0 41.0 72-73 35.338375 36.5 35.0 39.0 30.5 41.0 74-75 35.153999999999996 36.0 35.0 39.0 31.0 40.0 76-77 33.545874999999995 35.0 33.0 36.5 28.5 39.0 78-79 33.994125 35.0 34.0 37.0 29.5 39.0 80-81 33.946 35.0 34.0 36.5 30.0 38.0 82-83 33.7645 35.0 34.0 36.0 30.0 37.0 84-85 33.472625 35.0 34.0 36.0 30.0 37.0 86-87 33.236375 35.0 34.0 35.0 30.0 36.5 88-89 32.827125 35.0 34.0 35.0 29.5 36.0 90-91 32.544375 35.0 34.0 35.0 29.0 36.0 92-93 32.332499999999996 35.0 34.0 35.0 28.5 36.0 94-95 32.093875 35.0 33.0 35.0 27.5 35.0 96-97 31.775875 35.0 33.0 35.0 26.0 35.0 98-99 31.5295 35.0 33.0 35.0 25.0 35.0 100 31.4895 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 1.0 11 3.0 12 6.0 13 5.0 14 3.0 15 8.0 16 4.0 17 3.0 18 4.0 19 5.0 20 3.0 21 6.0 22 12.0 23 10.0 24 7.0 25 16.0 26 16.0 27 29.0 28 31.0 29 40.0 30 52.0 31 60.0 32 87.0 33 74.0 34 143.0 35 204.0 36 378.0 37 833.0 38 1581.0 39 371.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.558540293968573 14.749113025848962 17.283324885960464 41.40902179422199 2 20.525 23.275000000000002 35.575 20.625 3 22.675 26.525 26.625 24.175 4 24.2 32.15 20.825 22.825 5 24.2 35.699999999999996 21.325 18.775 6 17.75 38.224999999999994 24.55 19.475 7 16.6 17.599999999999998 44.875 20.925 8 19.75 22.55 29.675 28.025 9 20.25 22.7 31.775 25.275 10-11 23.05 33.425 22.425 21.099999999999998 12-13 21.55 26.4625 29.9875 22.0 14-15 21.3 26.937499999999996 29.125 22.6375 16-17 22.2 27.8125 28.0875 21.9 18-19 22.7625 27.787499999999998 27.200000000000003 22.25 20-21 22.0875 28.1375 28.075 21.7 22-23 21.9625 27.55 28.4375 22.05 24-25 21.3 28.65 28.349999999999998 21.7 26-27 21.3625 28.499999999999996 27.200000000000003 22.9375 28-29 21.099999999999998 29.025000000000002 27.975 21.9 30-31 21.987499999999997 28.012500000000003 26.9625 23.0375 32-33 22.425 28.225 27.6 21.75 34-35 21.4875 28.3875 27.9125 22.2125 36-37 22.4625 28.525 26.937499999999996 22.075 38-39 21.55 29.025000000000002 28.050000000000004 21.375 40-41 21.8625 27.5625 28.549999999999997 22.025 42-43 22.225 27.962500000000002 28.075 21.7375 44-45 21.425 27.700000000000003 28.6625 22.2125 46-47 21.9 28.762500000000003 27.625 21.712500000000002 48-49 21.71628721541156 28.5839379534651 28.008506379784837 21.691268451338505 50-51 21.79134350763072 28.521391043282463 27.495621716287218 22.191643732799598 52-53 21.837500000000002 28.3625 27.437499999999996 22.3625 54-55 21.15 27.962500000000002 28.6625 22.225 56-57 22.175 28.425 27.675 21.725 58-59 21.893416927899686 28.940438871473358 27.247648902821314 21.91849529780564 60-61 21.510673234811165 29.089301503094607 27.560944802324112 21.839080459770116 62-63 21.949367088607595 28.835443037974684 27.658227848101262 21.556962025316455 64-65 21.742957746478872 27.91750503018109 28.470824949698187 21.86871227364185 66-67 21.375 28.775000000000002 28.262500000000003 21.587500000000002 68-69 23.0125 28.549999999999997 27.375 21.0625 70-71 22.275 27.537499999999998 27.737499999999997 22.45 72-73 21.5625 28.325 27.712500000000002 22.400000000000002 74-75 22.125 28.15 27.55 22.175 76-77 22.161080540270135 28.026513256628316 28.16408204102051 21.64832416208104 78-79 22.7375 28.075 28.000000000000004 21.1875 80-81 21.5 29.312500000000004 27.6625 21.525 82-83 22.825 28.5875 27.925 20.6625 84-85 21.5625 28.475 28.249999999999996 21.712500000000002 86-87 20.962500000000002 28.1625 28.6625 22.2125 88-89 22.575 28.262500000000003 27.55 21.6125 90-91 22.6125 27.35 27.8125 22.225 92-93 22.925 28.487499999999997 27.8375 20.75 94-95 22.975 27.224999999999998 27.500000000000004 22.3 96-97 21.825 28.675 28.025 21.475 98-99 22.7375 29.225 27.187499999999996 20.849999999999998 100 22.525000000000002 28.725 26.400000000000002 22.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 4.0 26 4.5 27 2.0 28 6.5 29 11.5 30 18.0 31 30.5 32 43.0 33 49.5 34 52.5 35 71.5 36 104.5 37 116.5 38 144.0 39 174.5 40 185.0 41 212.5 42 248.5 43 271.5 44 272.5 45 261.5 46 258.5 47 254.5 48 229.5 49 205.0 50 163.5 51 117.0 52 101.5 53 86.5 54 63.0 55 51.5 56 40.0 57 28.0 58 22.0 59 16.5 60 13.5 61 15.0 62 10.5 63 6.0 64 6.0 65 2.0 66 1.0 67 3.5 68 4.0 69 2.5 70 2.5 71 1.5 72 1.0 73 1.0 74 0.0 75 0.5 76 1.0 77 1.5 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.075 50-51 0.075 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.3125 60-61 1.0375 62-63 1.25 64-65 0.6 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.05 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965950 spots for SRR3207869.sra Written 965950 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra Read 965931 spots for SRR3207869.sra Written 965931 spots for SRR3207869.sra SRR ids: ['SRR3207869.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mxtv791e SRR3207869.sra spots: 19318639 blocks: [[1, 965931], [965932, 1931862], [1931863, 2897793], [2897794, 3863724], [3863725, 4829655], [4829656, 5795586], [5795587, 6761517], [6761518, 7727448], [7727449, 8693379], [8693380, 9659310], [9659311, 10625241], [10625242, 11591172], [11591173, 12557103], [12557104, 13523034], [13523035, 14488965], [14488966, 15454896], [15454897, 16420827], [16420828, 17386758], [17386759, 18352689], [18352690, 19318639]] SRR3207869 file size 5026754 SRR3207869 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207869 SRR3207869_1.fastq Input file: SRR3207869_1.fastq trimmed: SRR3207869-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:26:06 2025 >> started Tue Feb 11 10:26:17 2025 >> done (10.743s) 19318639 reads processed; of these: 2501 ( 0.01%) short reads filtered out after trimming by size control 4310 ( 0.02%) empty reads filtered out after trimming by size control 19311828 (99.96%) reads available; of these: 1167072 ( 6.04%) trimmed reads available after processing 18144756 (93.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 445 0.00% 19 599 0.00% 20 720 0.00% 21 1004 0.01% 22 1326 0.01% 23 1811 0.01% 24 2407 0.01% 25 3036 0.02% 26 3172 0.02% 27 3099 0.02% 28 3235 0.02% 29 3364 0.02% 30 3380 0.02% 31 3397 0.02% 32 3675 0.02% 33 3679 0.02% 34 3780 0.02% 35 3981 0.02% 36 4156 0.02% 37 4885 0.03% 38 4402 0.02% 39 4654 0.02% 40 4607 0.02% 41 4639 0.02% 42 4860 0.03% 43 4928 0.03% 44 5196 0.03% 45 5485 0.03% 46 5815 0.03% 47 5816 0.03% 48 5564 0.03% 49 6021 0.03% 50 5689 0.03% 51 5809 0.03% 52 6158 0.03% 53 6383 0.03% 54 6857 0.04% 55 6808 0.04% 56 7130 0.04% 57 7248 0.04% 58 7454 0.04% 59 7966 0.04% 60 8003 0.04% 61 8190 0.04% 62 8585 0.04% 63 8457 0.04% 64 8697 0.05% 65 9069 0.05% 66 9721 0.05% 67 9690 0.05% 68 10339 0.05% 69 10297 0.05% 70 11092 0.06% 71 11474 0.06% 72 12295 0.06% 73 12876 0.07% 74 13259 0.07% 75 13891 0.07% 76 7856 0.04% 77 8899 0.05% 78 10819 0.06% 79 12055 0.06% 80 12820 0.07% 81 14102 0.07% 82 14816 0.08% 83 16263 0.08% 84 16727 0.09% 85 17823 0.09% 86 19156 0.10% 87 20776 0.11% 88 22598 0.12% 89 24676 0.13% 90 27324 0.14% 91 30838 0.16% 92 35066 0.18% 93 40707 0.21% 94 48169 0.25% 95 57748 0.30% 96 70124 0.36% 97 83766 0.43% 98 98208 0.51% 99 105161 0.54% 100 18144756 93.96% 19311828 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=85.25 fanout-score-rank=4 prefix-density=0.66 prefix-fanout=40.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=181.35 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=24.6 sequence=AAGAAGAAGAAA Started job on | Feb 11 10:26:35 Started mapping on | Feb 11 10:26:35 Finished on | Feb 11 10:26:55 Mapping speed, Million of reads per hour | 3476.13 Number of input reads | 19311828 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 18533587 Uniquely mapped reads % | 95.97% Average mapped length | 98.51 Number of splices: Total | 5282247 Number of splices: Annotated (sjdb) | 5180970 Number of splices: GT/AG | 5199106 Number of splices: GC/AG | 67999 Number of splices: AT/AC | 5361 Number of splices: Non-canonical | 9781 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.96 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450272 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 189479 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 327969 327969 327969 N_multimapping 450272 450272 450272 N_noFeature 798889 9545013 9662966 N_ambiguous 187560 31638 31772 UnstrandedReadsAssigned:17547138 PositiveStrandReadsAssigned:8956936 NegativeStrandReadsAssigned:8838849 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207869 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207869-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,311,828 reads, 18,059,141 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR3207869.ke.tsv 34699 SRR3207869.se.tsv 87100 total ==> SRR3207869.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 737 30.9103 Potri.005G024800.1.v4.1 1035 936 112 9.6306 Potri.004G059700.1.v4.1 961 862 19 1.77402 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 386.746 10.9448 Potri.016G087400.1.v4.1 270 171 851 400.539 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 82 3.94248 Potri.012G127500.1.v4.1 977 878 3499 320.745 ==> SRR3207869.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1678 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 423 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 19 SRR3207869 completed mapping pipeline successfully