Starting /dee2/code/volunteer_pipeline.sh SRR3207870 current disk space = 3053216370688 free memory = 1480765124 SRR3207870 SRAfilesize 7fdca4815083ab194cdf7b5183b9405f SRR3207870.sra SRR3207870.sra file validated SRR3207870 is single end SRR3207870 is conventional basespace SRR3207870 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207870_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.152 34.0 31.0 34.0 31.0 34.0 2 32.66325 34.0 33.0 34.0 31.0 34.0 3 33.088 34.0 34.0 34.0 31.0 34.0 4 36.51025 37.0 37.0 37.0 35.0 37.0 5 36.445 37.0 37.0 37.0 35.0 37.0 6 36.48675 37.0 37.0 37.0 35.0 37.0 7 36.43975 37.0 37.0 37.0 35.0 37.0 8 36.3865 37.0 37.0 37.0 35.0 37.0 9 38.1015 39.0 39.0 39.0 35.0 39.0 10-11 38.278499999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.233625 39.0 39.0 39.0 37.0 39.0 14-15 39.76625 41.0 40.0 41.0 37.5 41.0 16-17 39.7825 41.0 40.0 41.0 38.0 41.0 18-19 39.76775 41.0 40.0 41.0 38.0 41.0 20-21 39.631375 41.0 40.0 41.0 37.0 41.0 22-23 39.603375 41.0 40.0 41.0 37.0 41.0 24-25 39.591750000000005 41.0 40.0 41.0 37.0 41.0 26-27 39.265 41.0 39.0 41.0 36.5 41.0 28-29 39.310875 41.0 39.0 41.0 36.0 41.0 30-31 39.25 41.0 39.0 41.0 36.0 41.0 32-33 39.211875 40.0 39.0 41.0 36.0 41.0 34-35 39.00275 40.0 39.0 41.0 36.0 41.0 36-37 38.948499999999996 40.0 38.0 41.0 35.5 41.0 38-39 38.7285 40.0 38.0 41.0 35.0 41.0 40-41 38.699625 40.0 38.0 41.0 35.0 41.0 42-43 38.712 40.0 38.0 41.0 35.0 41.0 44-45 38.68725 40.0 38.0 41.0 35.0 41.0 46-47 38.397875 40.0 38.0 41.0 34.0 41.0 48-49 38.25275 40.0 38.0 41.0 33.0 41.0 50-51 38.376625000000004 40.0 38.0 41.0 34.5 41.0 52-53 38.588375 40.0 38.0 41.0 35.0 41.0 54-55 38.5745 40.0 38.0 41.0 34.5 41.0 56-57 38.480374999999995 40.0 38.0 41.0 34.0 41.0 58-59 38.315625 40.0 37.5 41.0 34.0 41.0 60-61 38.1245 40.0 37.0 41.0 34.0 41.0 62-63 37.835499999999996 39.5 37.0 41.0 34.0 41.0 64-65 37.52525 39.0 36.0 41.0 33.5 41.0 66-67 37.177875 39.0 36.0 41.0 33.0 41.0 68-69 36.8615 38.5 35.0 40.0 33.0 41.0 70-71 36.472875 37.0 35.0 39.5 33.0 41.0 72-73 35.903999999999996 37.0 35.0 39.0 32.0 41.0 74-75 35.318749999999994 36.0 35.0 39.0 31.0 40.0 76-77 33.832 35.0 33.0 36.5 29.5 39.0 78-79 34.5525 35.0 34.0 37.0 31.0 39.0 80-81 34.289125 35.0 34.0 37.0 30.5 38.0 82-83 34.091625 35.0 34.0 36.0 31.0 37.0 84-85 33.710875 35.0 34.0 36.0 30.5 37.0 86-87 33.4925 35.0 34.0 35.5 30.5 36.5 88-89 33.256375 35.0 34.0 35.0 30.0 36.0 90-91 33.0035 35.0 34.0 35.0 29.5 36.0 92-93 32.97475 35.0 34.0 35.0 30.0 36.0 94-95 32.81875 35.0 34.0 35.0 29.5 35.5 96-97 32.566 35.0 34.0 35.0 29.0 35.0 98-99 32.452375 35.0 34.0 35.0 29.0 35.0 100 32.198 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 2.0 11 0.0 12 2.0 13 4.0 14 1.0 15 4.0 16 3.0 17 3.0 18 11.0 19 4.0 20 5.0 21 5.0 22 7.0 23 7.0 24 16.0 25 6.0 26 14.0 27 18.0 28 21.0 29 25.0 30 42.0 31 59.0 32 59.0 33 89.0 34 119.0 35 209.0 36 360.0 37 967.0 38 1583.0 39 350.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.155727155727156 13.822393822393822 18.12097812097812 40.9009009009009 2 19.900000000000002 23.025000000000002 36.675000000000004 20.4 3 23.425 26.200000000000003 27.075 23.3 4 25.85 32.4 19.55 22.2 5 24.0 34.65 22.975 18.375 6 19.475 36.55 24.349999999999998 19.625 7 17.75 18.375 44.324999999999996 19.55 8 19.6 23.75 28.749999999999996 27.900000000000002 9 20.25 23.400000000000002 30.775000000000002 25.575 10-11 22.725 33.85 22.237499999999997 21.1875 12-13 20.625 27.9125 28.8875 22.575 14-15 20.825 27.437499999999996 28.625 23.1125 16-17 22.55 27.6875 27.675 22.0875 18-19 20.9375 28.749999999999996 27.250000000000004 23.0625 20-21 21.5625 28.549999999999997 27.950000000000003 21.9375 22-23 22.075 28.599999999999998 27.275 22.05 24-25 21.3625 28.4375 27.762500000000003 22.4375 26-27 21.55 28.712500000000002 28.249999999999996 21.4875 28-29 21.0125 28.5875 27.8625 22.537499999999998 30-31 21.3625 28.425 27.8125 22.400000000000002 32-33 21.575 28.3875 27.9375 22.1 34-35 22.287499999999998 28.125 27.9375 21.65 36-37 21.3125 29.025000000000002 27.437499999999996 22.225 38-39 22.2625 27.925 28.262500000000003 21.55 40-41 22.575 28.225 27.4125 21.7875 42-43 22.125 28.537499999999998 27.5625 21.775 44-45 22.237499999999997 28.349999999999998 27.224999999999998 22.1875 46-47 21.7375 28.775000000000002 27.962500000000002 21.525 48-49 22.336168084042022 27.888944472236116 27.43871935967984 22.336168084042022 50-51 21.785892946473236 28.451725862931465 28.12656328164082 21.635817908954476 52-53 21.65 28.1375 28.1125 22.1 54-55 21.8125 28.1 27.3125 22.775000000000002 56-57 21.2625 27.700000000000003 29.175 21.8625 58-59 21.675 28.3375 28.0875 21.9 60-61 22.15 28.725 28.199999999999996 20.925 62-63 22.1875 27.675 28.5625 21.575 64-65 21.712500000000002 27.725 28.712500000000002 21.85 66-67 22.325 27.9125 27.950000000000003 21.8125 68-69 21.7875 27.4125 28.512500000000003 22.287499999999998 70-71 22.225 28.449999999999996 27.175 22.15 72-73 21.0625 27.987499999999997 27.9125 23.0375 74-75 21.192798199549888 28.68217054263566 27.51937984496124 22.605651412853213 76-77 21.548274137068535 28.61430715357679 27.763881940970485 22.07353676838419 78-79 21.915239404925615 27.953494186773348 27.040880110013752 23.090386298287285 80-81 22.6 28.449999999999996 27.8125 21.1375 82-83 22.025 28.625 26.987499999999997 22.3625 84-85 21.4375 28.0625 27.462500000000002 23.0375 86-87 22.8875 27.725 27.6875 21.7 88-89 21.625 28.625 28.212500000000002 21.5375 90-91 22.537499999999998 27.525 27.625 22.3125 92-93 22.2125 27.825 28.212500000000002 21.75 94-95 22.625 28.5625 27.3 21.512500000000003 96-97 22.925 28.575 27.325 21.175 98-99 22.05 29.1625 27.1625 21.625 100 20.95 28.95 27.35 22.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 3.0 27 6.5 28 7.0 29 8.0 30 15.0 31 21.0 32 32.0 33 42.0 34 59.0 35 77.0 36 94.0 37 123.0 38 146.0 39 166.5 40 182.0 41 206.5 42 247.5 43 271.5 44 281.0 45 290.5 46 267.5 47 240.0 48 215.5 49 188.5 50 170.0 51 142.5 52 119.0 53 94.0 54 78.0 55 55.0 56 31.0 57 22.0 58 18.0 59 17.0 60 11.5 61 7.5 62 7.5 63 5.0 64 1.0 65 2.0 66 2.5 67 1.0 68 1.0 69 1.5 70 1.0 71 1.0 72 1.0 73 2.0 74 1.5 75 0.0 76 2.5 77 3.0 78 0.5 79 0.0 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.05 50-51 0.05 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.025 76-77 0.05 78-79 0.0125 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254322 spots for SRR3207870.sra Written 1254322 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra Read 1254319 spots for SRR3207870.sra Written 1254319 spots for SRR3207870.sra SRR ids: ['SRR3207870.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mqskz_ol SRR3207870.sra spots: 25086383 blocks: [[1, 1254319], [1254320, 2508638], [2508639, 3762957], [3762958, 5017276], [5017277, 6271595], [6271596, 7525914], [7525915, 8780233], [8780234, 10034552], [10034553, 11288871], [11288872, 12543190], [12543191, 13797509], [13797510, 15051828], [15051829, 16306147], [16306148, 17560466], [17560467, 18814785], [18814786, 20069104], [20069105, 21323423], [21323424, 22577742], [22577743, 23832061], [23832062, 25086383]] SRR3207870 file size 6530924 SRR3207870 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207870 SRR3207870_1.fastq Input file: SRR3207870_1.fastq trimmed: SRR3207870-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:29:57 2025 >> started Tue Feb 11 10:30:08 2025 >> done (11.140s) 25086383 reads processed; of these: 4153 ( 0.02%) short reads filtered out after trimming by size control 9194 ( 0.04%) empty reads filtered out after trimming by size control 25073036 (99.95%) reads available; of these: 1465565 ( 5.85%) trimmed reads available after processing 23607471 (94.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 679 0.00% 19 851 0.00% 20 989 0.00% 21 1234 0.00% 22 1696 0.01% 23 2400 0.01% 24 2998 0.01% 25 3748 0.01% 26 3784 0.02% 27 3786 0.02% 28 3970 0.02% 29 4065 0.02% 30 4305 0.02% 31 4329 0.02% 32 4561 0.02% 33 4674 0.02% 34 4917 0.02% 35 4935 0.02% 36 5173 0.02% 37 5418 0.02% 38 5345 0.02% 39 5705 0.02% 40 5875 0.02% 41 6591 0.03% 42 6570 0.03% 43 6573 0.03% 44 6702 0.03% 45 6990 0.03% 46 7502 0.03% 47 7612 0.03% 48 7147 0.03% 49 7285 0.03% 50 7128 0.03% 51 7326 0.03% 52 7608 0.03% 53 8302 0.03% 54 8579 0.03% 55 8924 0.04% 56 9077 0.04% 57 11115 0.04% 58 10586 0.04% 59 10416 0.04% 60 10220 0.04% 61 10745 0.04% 62 11146 0.04% 63 10747 0.04% 64 11124 0.04% 65 11396 0.05% 66 12350 0.05% 67 12017 0.05% 68 12776 0.05% 69 12797 0.05% 70 13701 0.05% 71 14508 0.06% 72 14755 0.06% 73 15516 0.06% 74 15698 0.06% 75 16230 0.06% 76 9583 0.04% 77 11193 0.04% 78 13327 0.05% 79 15143 0.06% 80 15792 0.06% 81 16990 0.07% 82 18496 0.07% 83 19748 0.08% 84 20607 0.08% 85 22091 0.09% 86 23145 0.09% 87 25646 0.10% 88 28049 0.11% 89 31202 0.12% 90 34259 0.14% 91 38392 0.15% 92 44065 0.18% 93 50877 0.20% 94 59799 0.24% 95 71438 0.28% 96 86605 0.35% 97 102945 0.41% 98 123204 0.49% 99 139773 0.56% 100 23607471 94.15% 25073036 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=83.77 fanout-score-rank=9 prefix-density=0.44 prefix-fanout=36.6 sequence=AGATCGGAAGAGCACACGTCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=295.64 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=27.5 sequence=TTCTTCTTCTTC Started job on | Feb 11 10:30:28 Started mapping on | Feb 11 10:30:29 Finished on | Feb 11 10:30:52 Mapping speed, Million of reads per hour | 3924.48 Number of input reads | 25073036 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 24091114 Uniquely mapped reads % | 96.08% Average mapped length | 98.58 Number of splices: Total | 7080593 Number of splices: Annotated (sjdb) | 6949393 Number of splices: GT/AG | 6969031 Number of splices: GC/AG | 91757 Number of splices: AT/AC | 7269 Number of splices: Non-canonical | 12536 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 584376 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 260980 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 397546 397546 397546 N_multimapping 584376 584376 584376 N_noFeature 1046192 12432605 12557886 N_ambiguous 228631 41163 41042 UnstrandedReadsAssigned:22816291 PositiveStrandReadsAssigned:11617346 NegativeStrandReadsAssigned:11492186 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207870 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207870-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,073,036 reads, 23,480,032 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR3207870.ke.tsv 34699 SRR3207870.se.tsv 87100 total ==> SRR3207870.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 803 26.1813 Potri.005G024800.1.v4.1 1035 936 156 10.428 Potri.004G059700.1.v4.1 961 862 26 1.88719 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 435.385 9.57843 Potri.016G087400.1.v4.1 270 171 1158 423.705 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 123 4.59727 Potri.012G127500.1.v4.1 977 878 4786 341.058 ==> SRR3207870.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2381 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 466 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207870 completed mapping pipeline successfully