Starting /dee2/code/volunteer_pipeline.sh SRR3207871 current disk space = 3053344780288 free memory = 1447770448 SRR3207871 SRAfilesize 7a34825edba7cc247ae2ad9d9f70900d SRR3207871.sra SRR3207871.sra file validated SRR3207871 is single end SRR3207871 is conventional basespace SRR3207871 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207871_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4905 34.0 33.0 34.0 31.0 34.0 2 33.12525 34.0 34.0 34.0 31.0 34.0 3 33.188 34.0 33.0 34.0 31.0 34.0 4 36.5565 37.0 37.0 37.0 35.0 37.0 5 36.6305 37.0 37.0 37.0 35.0 37.0 6 36.73025 37.0 37.0 37.0 37.0 37.0 7 36.7715 37.0 37.0 37.0 37.0 37.0 8 36.76175 37.0 37.0 37.0 37.0 37.0 9 38.727 39.0 39.0 39.0 39.0 39.0 10-11 38.709375 39.0 39.0 39.0 39.0 39.0 12-13 38.709999999999994 39.0 39.0 39.0 38.5 39.0 14-15 40.4195 41.0 41.0 41.0 39.0 41.0 16-17 40.34225 41.0 41.0 41.0 39.0 41.0 18-19 40.34525 41.0 40.0 41.0 39.0 41.0 20-21 40.288375 41.0 40.0 41.0 39.0 41.0 22-23 40.18625 41.0 40.0 41.0 39.0 41.0 24-25 40.13575 41.0 40.0 41.0 38.0 41.0 26-27 40.001625000000004 41.0 40.0 41.0 38.0 41.0 28-29 39.898375 41.0 40.0 41.0 38.0 41.0 30-31 39.661 41.0 40.0 41.0 38.0 41.0 32-33 39.659375 41.0 40.0 41.0 38.0 41.0 34-35 39.620875 41.0 40.0 41.0 38.0 41.0 36-37 39.52675 41.0 40.0 41.0 37.5 41.0 38-39 39.366 41.0 40.0 41.0 37.0 41.0 40-41 39.17675 41.0 39.0 41.0 36.5 41.0 42-43 39.480625 41.0 40.0 41.0 37.5 41.0 44-45 39.510374999999996 41.0 40.0 41.0 37.0 41.0 46-47 39.408 41.0 40.0 41.0 37.0 41.0 48-49 39.297375 41.0 40.0 41.0 37.0 41.0 50-51 39.117999999999995 41.0 40.0 41.0 36.5 41.0 52-53 38.966375 41.0 39.5 41.0 36.0 41.0 54-55 38.804874999999996 41.0 39.0 41.0 35.5 41.0 56-57 38.60925 41.0 39.0 41.0 35.0 41.0 58-59 38.406625000000005 40.5 38.5 41.0 35.0 41.0 60-61 38.076499999999996 40.0 38.0 41.0 34.0 41.0 62-63 37.8805 40.0 37.0 41.0 34.0 41.0 64-65 37.472750000000005 39.5 37.0 41.0 33.5 41.0 66-67 37.051500000000004 39.0 36.0 41.0 33.0 41.0 68-69 36.479875 38.5 35.5 40.5 32.5 41.0 70-71 35.95625 37.0 35.0 40.0 31.0 41.0 72-73 35.682625 37.0 35.0 39.0 32.0 41.0 74-75 35.203625 36.5 35.0 39.0 31.0 40.5 76-77 34.143375 35.5 34.0 37.0 30.0 39.0 78-79 34.16975 35.5 34.0 37.0 30.0 39.0 80-81 33.68425 35.0 34.0 37.0 30.0 38.5 82-83 33.43825 35.0 34.0 36.0 30.0 37.0 84-85 33.158625 35.0 34.0 36.0 29.0 37.0 86-87 32.813500000000005 35.0 34.0 35.5 29.0 36.5 88-89 32.534125 35.0 34.0 35.0 28.5 36.0 90-91 32.329750000000004 35.0 34.0 35.0 28.0 36.0 92-93 32.001375 35.0 33.0 35.0 27.0 36.0 94-95 31.849125 35.0 33.0 35.0 26.5 35.0 96-97 31.621625 35.0 33.0 35.0 25.5 35.0 98-99 31.291375000000002 35.0 33.0 35.0 25.0 35.0 100 30.92025 35.0 33.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 3.0 11 3.0 12 4.0 13 4.0 14 3.0 15 3.0 16 10.0 17 12.0 18 10.0 19 9.0 20 18.0 21 9.0 22 7.0 23 10.0 24 10.0 25 15.0 26 12.0 27 20.0 28 18.0 29 20.0 30 28.0 31 33.0 32 48.0 33 65.0 34 85.0 35 143.0 36 272.0 37 876.0 38 1781.0 39 468.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.165043567401334 14.633521271143005 16.940030753459766 40.2614044079959 2 19.7 22.8 38.0 19.5 3 21.2 27.1 28.799999999999997 22.900000000000002 4 23.55588897224306 33.53338334583646 20.655163790947736 22.255563890972745 5 24.675 35.0 22.025 18.3 6 18.275 36.675000000000004 24.85 20.200000000000003 7 16.725 17.724999999999998 44.125 21.425 8 18.099999999999998 23.200000000000003 29.65 29.049999999999997 9 19.45 22.725 32.800000000000004 25.025 10-11 22.662499999999998 32.8125 22.2 22.325 12-13 20.8 26.075 30.612499999999997 22.5125 14-15 20.424999999999997 27.3875 29.475 22.7125 16-17 20.8 27.8625 28.15 23.1875 18-19 21.587500000000002 28.050000000000004 28.4 21.9625 20-21 21.5 28.4375 28.012500000000003 22.05 22-23 22.175 28.4375 27.6375 21.75 24-25 21.5375 28.675 27.725 22.0625 26-27 21.95 28.6875 27.8125 21.55 28-29 21.975 29.4375 26.75 21.837500000000002 30-31 21.45 28.6375 27.875 22.037499999999998 32-33 22.075 29.362500000000004 26.5375 22.025 34-35 21.075 29.3875 27.150000000000002 22.3875 36-37 21.587500000000002 28.3375 27.962500000000002 22.112499999999997 38-39 21.512500000000003 29.225 27.175 22.0875 40-41 22.4875 28.075 28.125 21.3125 42-43 21.4125 29.2 28.212500000000002 21.175 44-45 22.3125 28.3875 28.0625 21.2375 46-47 21.725 27.650000000000002 28.075 22.55 48-49 22.575 27.875 27.700000000000003 21.85 50-51 21.85 28.125 27.800000000000004 22.225 52-53 21.6875 28.525 28.5875 21.2 54-55 22.0875 27.712500000000002 28.3625 21.837500000000002 56-57 21.4875 27.675 28.9875 21.85 58-59 22.2625 29.225 27.787499999999998 20.724999999999998 60-61 21.875 28.9125 27.037499999999998 22.175 62-63 21.337500000000002 29.0875 28.125 21.45 64-65 21.825 28.9375 27.5875 21.65 66-67 20.8 28.825 28.625 21.75 68-69 22.0 28.1 28.4125 21.4875 70-71 21.7 28.262500000000003 28.4125 21.625 72-73 22.1 27.762500000000003 28.762500000000003 21.375 74-75 22.0875 28.599999999999998 27.6875 21.625 76-77 22.7125 28.0875 28.499999999999996 20.7 78-79 22.3 28.5875 27.6375 21.475 80-81 22.112499999999997 27.150000000000002 28.050000000000004 22.6875 82-83 22.0625 27.800000000000004 27.9375 22.2 84-85 21.95 27.8625 28.675 21.512500000000003 86-87 22.625 28.4375 27.787499999999998 21.15 88-89 22.275 29.012500000000003 27.5625 21.15 90-91 22.525000000000002 27.975 28.1875 21.3125 92-93 22.8625 28.0625 27.725 21.349999999999998 94-95 22.3375 28.125 28.000000000000004 21.5375 96-97 21.2 28.6875 28.3625 21.75 98-99 21.587500000000002 28.575 28.925 20.9125 100 21.875 29.475 27.025 21.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 1.0 20 0.5 21 0.0 22 1.0 23 2.0 24 2.5 25 3.0 26 2.5 27 6.0 28 9.5 29 15.5 30 26.0 31 28.5 32 38.5 33 54.5 34 70.0 35 89.5 36 109.0 37 124.5 38 137.0 39 164.5 40 193.5 41 211.0 42 231.0 43 249.0 44 263.5 45 273.0 46 275.0 47 249.0 48 218.5 49 191.0 50 161.0 51 131.0 52 102.5 53 87.0 54 68.5 55 51.0 56 35.0 57 24.0 58 16.5 59 11.5 60 11.5 61 11.0 62 10.0 63 9.0 64 6.5 65 4.5 66 1.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 1.0 77 1.0 78 2.0 79 2.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104261 spots for SRR3207871.sra Written 1104261 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra Read 1104255 spots for SRR3207871.sra Written 1104255 spots for SRR3207871.sra SRR ids: ['SRR3207871.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dv6_d3s6 SRR3207871.sra spots: 22085106 blocks: [[1, 1104255], [1104256, 2208510], [2208511, 3312765], [3312766, 4417020], [4417021, 5521275], [5521276, 6625530], [6625531, 7729785], [7729786, 8834040], [8834041, 9938295], [9938296, 11042550], [11042551, 12146805], [12146806, 13251060], [13251061, 14355315], [14355316, 15459570], [15459571, 16563825], [16563826, 17668080], [17668081, 18772335], [18772336, 19876590], [19876591, 20980845], [20980846, 22085106]] SRR3207871 file size 5736977 SRR3207871 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207871 SRR3207871_1.fastq Input file: SRR3207871_1.fastq trimmed: SRR3207871-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:19:30 2025 >> started Tue Feb 11 10:19:41 2025 >> done (11.166s) 22085106 reads processed; of these: 4000 ( 0.02%) short reads filtered out after trimming by size control 24129 ( 0.11%) empty reads filtered out after trimming by size control 22056977 (99.87%) reads available; of these: 1385743 ( 6.28%) trimmed reads available after processing 20671234 (93.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 781 0.00% 19 1063 0.00% 20 1311 0.01% 21 1753 0.01% 22 2706 0.01% 23 3726 0.02% 24 4904 0.02% 25 6217 0.03% 26 5844 0.03% 27 6136 0.03% 28 6384 0.03% 29 6442 0.03% 30 6728 0.03% 31 6683 0.03% 32 6761 0.03% 33 6843 0.03% 34 7051 0.03% 35 7295 0.03% 36 7309 0.03% 37 7476 0.03% 38 7516 0.03% 39 7596 0.03% 40 7208 0.03% 41 7107 0.03% 42 7088 0.03% 43 7705 0.03% 44 7991 0.04% 45 8200 0.04% 46 8780 0.04% 47 9082 0.04% 48 9269 0.04% 49 9349 0.04% 50 9507 0.04% 51 9549 0.04% 52 9697 0.04% 53 9917 0.04% 54 9956 0.05% 55 9849 0.04% 56 10441 0.05% 57 11642 0.05% 58 11567 0.05% 59 11157 0.05% 60 11352 0.05% 61 11468 0.05% 62 11825 0.05% 63 11777 0.05% 64 11936 0.05% 65 12193 0.06% 66 12305 0.06% 67 13218 0.06% 68 13671 0.06% 69 13630 0.06% 70 13683 0.06% 71 13844 0.06% 72 14231 0.06% 73 14618 0.07% 74 15002 0.07% 75 15496 0.07% 76 11579 0.05% 77 12214 0.06% 78 14424 0.07% 79 15059 0.07% 80 15996 0.07% 81 16573 0.08% 82 17315 0.08% 83 19125 0.09% 84 19578 0.09% 85 21217 0.10% 86 22667 0.10% 87 21324 0.10% 88 23277 0.11% 89 25171 0.11% 90 27208 0.12% 91 31136 0.14% 92 37006 0.17% 93 41592 0.19% 94 47687 0.22% 95 55404 0.25% 96 68666 0.31% 97 88779 0.40% 98 97871 0.44% 99 121040 0.55% 100 20671234 93.72% 22056977 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=29.39 fanout-score-rank=11 prefix-density=0.21 prefix-fanout=24.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=253.71 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.4 sequence=TTCTTCTTCTTT Started job on | Feb 11 10:20:01 Started mapping on | Feb 11 10:20:01 Finished on | Feb 11 10:20:20 Mapping speed, Million of reads per hour | 4179.22 Number of input reads | 22056977 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 21286844 Uniquely mapped reads % | 96.51% Average mapped length | 98.42 Number of splices: Total | 5737100 Number of splices: Annotated (sjdb) | 5626162 Number of splices: GT/AG | 5649643 Number of splices: GC/AG | 71219 Number of splices: AT/AC | 6022 Number of splices: Non-canonical | 10216 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 504130 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 159102 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 266003 266003 266003 N_multimapping 504130 504130 504130 N_noFeature 980039 11029802 11073309 N_ambiguous 239960 37946 38631 UnstrandedReadsAssigned:20066845 PositiveStrandReadsAssigned:10219096 NegativeStrandReadsAssigned:10174904 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207871 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207871-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,056,977 reads, 20,583,628 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR3207871.ke.tsv 34699 SRR3207871.se.tsv 87100 total ==> SRR3207871.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1488 53.1506 Potri.005G024800.1.v4.1 1035 936 240 17.5758 Potri.004G059700.1.v4.1 961 862 38 3.02174 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 331.505 7.98988 Potri.016G087400.1.v4.1 270 171 940 376.801 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 67.5072 2.76424 Potri.012G127500.1.v4.1 977 878 4281 334.219 ==> SRR3207871.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2499 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 478 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207871 completed mapping pipeline successfully