Starting /dee2/code/volunteer_pipeline.sh SRR3207872 current disk space = 3053300531200 free memory = 1441552988 SRR3207872 SRAfilesize 4e220c04a64e02703493825ed791ce2c SRR3207872.sra SRR3207872.sra file validated SRR3207872 is single end SRR3207872 is conventional basespace SRR3207872 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207872_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4305 34.0 33.0 34.0 31.0 34.0 2 33.1035 34.0 34.0 34.0 31.0 34.0 3 33.1855 34.0 33.0 34.0 31.0 34.0 4 36.503 37.0 37.0 37.0 35.0 37.0 5 36.62575 37.0 37.0 37.0 35.0 37.0 6 36.7165 37.0 37.0 37.0 36.0 37.0 7 36.75475 37.0 37.0 37.0 37.0 37.0 8 36.74275 37.0 37.0 37.0 37.0 37.0 9 38.7085 39.0 39.0 39.0 38.0 39.0 10-11 38.697625 39.0 39.0 39.0 38.5 39.0 12-13 38.623375 39.0 39.0 39.0 38.0 39.0 14-15 40.41375 41.0 41.0 41.0 39.5 41.0 16-17 40.35875 41.0 41.0 41.0 39.0 41.0 18-19 40.31125 41.0 40.0 41.0 39.0 41.0 20-21 40.281875 41.0 40.0 41.0 39.0 41.0 22-23 40.177625000000006 41.0 40.0 41.0 38.5 41.0 24-25 40.055499999999995 41.0 40.0 41.0 38.0 41.0 26-27 39.92075 41.0 40.0 41.0 38.0 41.0 28-29 39.767250000000004 41.0 40.0 41.0 38.0 41.0 30-31 39.587875 41.0 40.0 41.0 37.5 41.0 32-33 39.588 41.0 40.0 41.0 38.0 41.0 34-35 39.512125 41.0 40.0 41.0 37.5 41.0 36-37 39.376999999999995 41.0 40.0 41.0 37.5 41.0 38-39 39.219125 41.0 40.0 41.0 37.0 41.0 40-41 39.017125 41.0 39.0 41.0 36.0 41.0 42-43 39.312 41.0 40.0 41.0 37.0 41.0 44-45 39.272625000000005 41.0 40.0 41.0 37.0 41.0 46-47 39.205625 41.0 40.0 41.0 37.0 41.0 48-49 39.101124999999996 41.0 40.0 41.0 37.0 41.0 50-51 38.976 41.0 39.5 41.0 36.0 41.0 52-53 38.837125 41.0 39.0 41.0 35.5 41.0 54-55 38.608 41.0 39.0 41.0 35.0 41.0 56-57 38.302625 40.5 38.5 41.0 34.5 41.0 58-59 38.07725 40.0 38.0 41.0 34.0 41.0 60-61 37.816125 40.0 37.5 41.0 34.0 41.0 62-63 37.596625 40.0 37.0 41.0 33.5 41.0 64-65 37.2145 39.0 36.5 41.0 33.0 41.0 66-67 36.792500000000004 39.0 36.0 41.0 33.0 41.0 68-69 36.171875 38.5 35.0 40.5 31.5 41.0 70-71 35.672375 37.0 35.0 39.5 31.0 41.0 72-73 35.327625 37.0 35.0 39.0 31.0 41.0 74-75 34.887125 36.5 35.0 39.0 31.0 40.5 76-77 33.791125 35.0 33.5 37.0 29.5 39.0 78-79 33.809375 35.0 34.0 37.0 29.5 39.0 80-81 33.359875 35.0 34.0 36.5 29.0 38.0 82-83 33.07125 35.0 34.0 36.0 29.0 37.0 84-85 32.77675 35.0 34.0 36.0 29.0 37.0 86-87 32.52175 35.0 34.0 35.5 29.0 36.5 88-89 32.230374999999995 35.0 34.0 35.0 27.0 36.0 90-91 32.06525 35.0 34.0 35.0 27.0 36.0 92-93 31.748625 35.0 33.0 35.0 25.5 36.0 94-95 31.501625 35.0 33.0 35.0 25.0 35.0 96-97 31.3455 35.0 33.0 35.0 25.0 35.0 98-99 31.147624999999998 35.0 33.0 35.0 24.5 35.0 100 30.7325 35.0 33.0 35.0 19.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 4.0 11 5.0 12 8.0 13 9.0 14 6.0 15 8.0 16 6.0 17 7.0 18 13.0 19 10.0 20 10.0 21 8.0 22 22.0 23 11.0 24 16.0 25 14.0 26 11.0 27 11.0 28 21.0 29 32.0 30 24.0 31 40.0 32 43.0 33 72.0 34 88.0 35 140.0 36 306.0 37 879.0 38 1712.0 39 460.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.646983311938385 14.942233632862646 18.870346598202826 41.54043645699615 2 19.125 23.875 37.3 19.7 3 21.575 26.525 28.499999999999996 23.400000000000002 4 23.209814722083124 34.3014521782674 20.105157736604905 22.383575363044567 5 24.474999999999998 34.825 22.05 18.65 6 19.225 37.0 24.2 19.575 7 16.475 16.925 45.2 21.4 8 19.525000000000002 22.775000000000002 27.950000000000003 29.75 9 21.224999999999998 22.775000000000002 30.525000000000002 25.474999999999998 10-11 23.7875 33.300000000000004 22.4375 20.474999999999998 12-13 20.474999999999998 25.775 30.2875 23.4625 14-15 20.9 27.5125 28.925 22.662499999999998 16-17 22.05 27.275 28.225 22.45 18-19 21.7 27.875 27.487499999999997 22.9375 20-21 21.775 28.487499999999997 26.6625 23.075000000000003 22-23 21.4 29.275000000000002 27.187499999999996 22.1375 24-25 21.7 28.487499999999997 28.6375 21.175 26-27 22.175 27.537499999999998 27.712500000000002 22.575 28-29 21.837500000000002 27.1375 28.962500000000002 22.0625 30-31 22.225 28.0625 28.012500000000003 21.7 32-33 21.6125 29.0875 27.6375 21.6625 34-35 21.3 28.249999999999996 28.3375 22.112499999999997 36-37 21.2 28.262500000000003 27.525 23.0125 38-39 23.35 27.725 27.175 21.75 40-41 21.675 28.3875 27.487499999999997 22.45 42-43 21.8875 28.8625 27.762500000000003 21.4875 44-45 22.225 29.125 26.625 22.025 46-47 21.975 28.525 27.712500000000002 21.7875 48-49 21.675 28.025 27.0875 23.2125 50-51 21.2375 28.325 28.1375 22.3 52-53 21.8625 28.012500000000003 28.525 21.6 54-55 22.7125 26.987499999999997 28.4 21.9 56-57 22.1 27.775 28.012500000000003 22.112499999999997 58-59 21.825 28.249999999999996 28.9125 21.0125 60-61 21.637500000000003 27.224999999999998 28.3375 22.8 62-63 21.637500000000003 27.275 28.8875 22.2 64-65 21.6625 27.375 28.512500000000003 22.45 66-67 22.0625 28.249999999999996 27.450000000000003 22.237499999999997 68-69 22.162499999999998 28.0625 28.249999999999996 21.525 70-71 21.3625 28.375 27.650000000000002 22.6125 72-73 21.925 27.962500000000002 28.225 21.8875 74-75 21.212500000000002 27.3375 28.275 23.175 76-77 21.775 27.8625 28.299999999999997 22.0625 78-79 22.475 28.1125 27.987499999999997 21.425 80-81 22.25 27.6375 27.425 22.6875 82-83 21.6875 27.537499999999998 28.175 22.6 84-85 22.112499999999997 28.325 27.500000000000004 22.0625 86-87 21.8 28.262500000000003 28.025 21.912499999999998 88-89 22.95 27.800000000000004 27.650000000000002 21.6 90-91 21.462500000000002 28.3375 27.987499999999997 22.2125 92-93 22.575 26.737499999999997 28.4375 22.25 94-95 22.05 27.55 28.15 22.25 96-97 22.0125 28.000000000000004 27.6 22.3875 98-99 22.912499999999998 28.1625 27.8875 21.0375 100 22.325 28.449999999999996 28.075 21.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 3.5 25 4.5 26 4.5 27 4.5 28 7.0 29 14.5 30 17.0 31 20.5 32 35.0 33 48.5 34 62.0 35 84.0 36 102.5 37 124.0 38 152.0 39 173.5 40 193.0 41 214.0 42 218.0 43 234.5 44 272.5 45 276.0 46 247.5 47 237.0 48 215.5 49 186.0 50 160.0 51 138.5 52 124.0 53 92.5 54 72.5 55 49.5 56 33.5 57 29.5 58 24.0 59 18.0 60 15.5 61 16.0 62 12.5 63 8.5 64 5.0 65 4.0 66 4.0 67 2.5 68 3.5 69 4.5 70 2.0 71 2.0 72 3.5 73 3.0 74 2.0 75 1.0 76 0.5 77 1.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.5 87 1.5 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.15 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49672873678914 98.85000000000001 2 0.45294413688978363 0.8999999999999999 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025163563160543533 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.0625 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962076 spots for SRR3207872.sra Written 962076 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra Read 962061 spots for SRR3207872.sra Written 962061 spots for SRR3207872.sra SRR ids: ['SRR3207872.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__54vkpq1 SRR3207872.sra spots: 19241235 blocks: [[1, 962061], [962062, 1924122], [1924123, 2886183], [2886184, 3848244], [3848245, 4810305], [4810306, 5772366], [5772367, 6734427], [6734428, 7696488], [7696489, 8658549], [8658550, 9620610], [9620611, 10582671], [10582672, 11544732], [11544733, 12506793], [12506794, 13468854], [13468855, 14430915], [14430916, 15392976], [15392977, 16355037], [16355038, 17317098], [17317099, 18279159], [18279160, 19241235]] SRR3207872 file size 4996845 SRR3207872 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207872 SRR3207872_1.fastq Input file: SRR3207872_1.fastq trimmed: SRR3207872-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:25:39 2025 >> started Tue Feb 11 10:25:49 2025 >> done (9.721s) 19241235 reads processed; of these: 4904 ( 0.03%) short reads filtered out after trimming by size control 35038 ( 0.18%) empty reads filtered out after trimming by size control 19201293 (99.79%) reads available; of these: 1348230 ( 7.02%) trimmed reads available after processing 17853063 (92.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 882 0.00% 19 1149 0.01% 20 3612 0.02% 21 1917 0.01% 22 2841 0.01% 23 3954 0.02% 24 5211 0.03% 25 6397 0.03% 26 6383 0.03% 27 6039 0.03% 28 6425 0.03% 29 6615 0.03% 30 7061 0.04% 31 6825 0.04% 32 7153 0.04% 33 6728 0.04% 34 7041 0.04% 35 7195 0.04% 36 7453 0.04% 37 7425 0.04% 38 7659 0.04% 39 7536 0.04% 40 7126 0.04% 41 7084 0.04% 42 7294 0.04% 43 7590 0.04% 44 7853 0.04% 45 8062 0.04% 46 8611 0.04% 47 9039 0.05% 48 9219 0.05% 49 9325 0.05% 50 9164 0.05% 51 9643 0.05% 52 9701 0.05% 53 9742 0.05% 54 9972 0.05% 55 9965 0.05% 56 10579 0.06% 57 11671 0.06% 58 11559 0.06% 59 11330 0.06% 60 11408 0.06% 61 11215 0.06% 62 11968 0.06% 63 12680 0.07% 64 11802 0.06% 65 12146 0.06% 66 12260 0.06% 67 12791 0.07% 68 13646 0.07% 69 13731 0.07% 70 13654 0.07% 71 13721 0.07% 72 14284 0.07% 73 14517 0.08% 74 14643 0.08% 75 15336 0.08% 76 11082 0.06% 77 11930 0.06% 78 14349 0.07% 79 14870 0.08% 80 15392 0.08% 81 16129 0.08% 82 17101 0.09% 83 18620 0.10% 84 19298 0.10% 85 21167 0.11% 86 22275 0.12% 87 21462 0.11% 88 22555 0.12% 89 24829 0.13% 90 26783 0.14% 91 30045 0.16% 92 35467 0.18% 93 39780 0.21% 94 44999 0.23% 95 52721 0.27% 96 64250 0.33% 97 83088 0.43% 98 90368 0.47% 99 111838 0.58% 100 17853063 92.98% 19201293 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=36.03 fanout-score-rank=7 prefix-density=0.26 prefix-fanout=28.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=7 fanout-score=181.37 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=25.0 sequence=AAGAAGAAGAAA Started job on | Feb 11 10:26:09 Started mapping on | Feb 11 10:26:09 Finished on | Feb 11 10:26:26 Mapping speed, Million of reads per hour | 4066.16 Number of input reads | 19201293 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 18009159 Uniquely mapped reads % | 93.79% Average mapped length | 98.34 Number of splices: Total | 4934655 Number of splices: Annotated (sjdb) | 4841546 Number of splices: GT/AG | 4860381 Number of splices: GC/AG | 60320 Number of splices: AT/AC | 5041 Number of splices: Non-canonical | 8913 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462255 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 630905 % of reads mapped to too many loci | 3.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 729879 729879 729879 N_multimapping 462255 462255 462255 N_noFeature 796454 9327740 9345961 N_ambiguous 194539 31119 31742 UnstrandedReadsAssigned:17018166 PositiveStrandReadsAssigned:8650300 NegativeStrandReadsAssigned:8631456 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207872 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207872-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,201,293 reads, 17,901,386 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 SRR3207872.ke.tsv 34699 SRR3207872.se.tsv 87100 total ==> SRR3207872.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 764 31.0975 Potri.005G024800.1.v4.1 1035 936 132 11.0155 Potri.004G059700.1.v4.1 961 862 21 1.90291 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 324.418 8.9101 Potri.016G087400.1.v4.1 270 171 812 370.909 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 47 2.19306 Potri.012G127500.1.v4.1 977 878 3412 303.544 ==> SRR3207872.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1937 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 427 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207872 completed mapping pipeline successfully