Starting /dee2/code/volunteer_pipeline.sh SRR3207874 current disk space = 3052812292096 free memory = 1063327052 SRR3207874 SRAfilesize aa81c87ec9b4afa4300b54f41ab4050b SRR3207874.sra SRR3207874.sra file validated SRR3207874 is single end SRR3207874 is conventional basespace SRR3207874 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207874_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.938 34.0 33.0 34.0 31.0 34.0 2 33.1665 34.0 34.0 34.0 31.0 34.0 3 33.3045 34.0 34.0 34.0 31.0 34.0 4 36.567 37.0 37.0 37.0 35.0 37.0 5 36.52575 37.0 37.0 37.0 35.0 37.0 6 36.51925 37.0 37.0 37.0 35.0 37.0 7 36.525 37.0 37.0 37.0 35.0 37.0 8 36.4865 37.0 37.0 37.0 35.0 37.0 9 38.32475 39.0 39.0 39.0 37.0 39.0 10-11 38.339375000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.28425 39.0 39.0 39.0 37.0 39.0 14-15 39.829625 41.0 40.0 41.0 37.5 41.0 16-17 39.756625 41.0 40.0 41.0 37.5 41.0 18-19 39.62175 41.0 40.0 41.0 37.0 41.0 20-21 39.548375 41.0 40.0 41.0 37.0 41.0 22-23 39.34525 41.0 39.0 41.0 36.0 41.0 24-25 39.413624999999996 41.0 39.0 41.0 36.5 41.0 26-27 39.203 41.0 39.0 41.0 36.0 41.0 28-29 39.183625 41.0 39.0 41.0 36.0 41.0 30-31 38.861625000000004 40.0 39.0 41.0 35.0 41.0 32-33 39.207375 41.0 39.0 41.0 36.0 41.0 34-35 39.235125 41.0 39.0 41.0 36.0 41.0 36-37 39.16775 41.0 39.0 41.0 36.0 41.0 38-39 38.892250000000004 41.0 39.0 41.0 35.0 41.0 40-41 38.798500000000004 40.0 39.0 41.0 35.0 41.0 42-43 38.972125000000005 40.0 39.0 41.0 35.0 41.0 44-45 38.91875 40.0 39.0 41.0 35.0 41.0 46-47 38.695499999999996 40.0 38.5 41.0 34.5 41.0 48-49 38.5685 40.0 38.0 41.0 34.5 41.0 50-51 38.395250000000004 40.0 38.0 41.0 34.0 41.0 52-53 38.50175 40.0 38.0 41.0 35.0 41.0 54-55 38.250875 40.0 38.0 41.0 34.0 41.0 56-57 38.121624999999995 40.0 38.0 41.0 34.0 41.0 58-59 37.7565 40.0 37.5 41.0 33.5 41.0 60-61 37.270875000000004 39.5 36.0 41.0 32.5 41.0 62-63 37.177125000000004 39.0 36.0 41.0 32.5 41.0 64-65 36.872625 39.0 36.0 40.5 32.0 41.0 66-67 36.49187499999999 38.5 35.0 40.0 32.0 41.0 68-69 36.164375 37.5 35.0 40.0 31.5 41.0 70-71 35.384125 37.0 35.0 39.0 30.0 41.0 72-73 34.892375 36.0 34.0 39.0 29.5 40.0 74-75 34.547625 36.0 34.0 38.5 29.5 40.0 76-77 33.520625 35.0 33.0 37.0 28.5 39.0 78-79 33.49525 35.0 34.0 37.0 29.0 39.0 80-81 33.584 35.0 34.0 36.5 29.5 38.0 82-83 33.351749999999996 35.0 34.0 36.0 29.5 37.0 84-85 33.132999999999996 35.0 34.0 36.0 29.0 37.0 86-87 32.78 35.0 34.0 35.0 29.0 36.0 88-89 32.430375 35.0 33.5 35.0 27.0 36.0 90-91 32.325125 35.0 33.0 35.0 28.5 36.0 92-93 32.017125 35.0 33.0 35.0 26.5 35.5 94-95 31.93625 35.0 33.0 35.0 26.5 35.0 96-97 31.786250000000003 35.0 33.0 35.0 26.5 35.0 98-99 31.670875000000002 35.0 33.0 35.0 27.0 35.0 100 31.39275 34.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 3.0 11 5.0 12 3.0 13 4.0 14 7.0 15 7.0 16 9.0 17 4.0 18 8.0 19 12.0 20 13.0 21 10.0 22 8.0 23 5.0 24 12.0 25 20.0 26 18.0 27 29.0 28 24.0 29 34.0 30 45.0 31 58.0 32 66.0 33 89.0 34 129.0 35 195.0 36 383.0 37 899.0 38 1591.0 39 308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.727501256913023 15.284062342885873 13.800904977375566 43.18753142282554 2 20.7 23.125 34.9 21.275 3 23.175 25.025 26.1 25.7 4 24.95 31.45 20.599999999999998 23.0 5 25.481370342585645 34.18354588647162 22.50562640660165 17.829457364341085 6 20.150000000000002 37.4 24.125 18.325 7 17.8 19.925 41.5 20.775 8 18.525 25.324999999999996 30.7 25.45 9 19.075 25.0 32.25 23.674999999999997 10-11 22.55 33.050000000000004 23.3125 21.087500000000002 12-13 20.474999999999998 28.075 28.4 23.05 14-15 22.0875 28.299999999999997 28.1125 21.5 16-17 22.1 27.650000000000002 28.1375 22.112499999999997 18-19 22.775000000000002 27.737499999999997 27.474999999999998 22.0125 20-21 22.125 28.125 27.650000000000002 22.1 22-23 21.3875 28.6125 28.325 21.675 24-25 21.6125 28.7 27.1 22.5875 26-27 22.1875 28.3375 27.675 21.8 28-29 21.85 28.050000000000004 28.125 21.975 30-31 21.5375 28.925 27.400000000000002 22.1375 32-33 21.6 28.8375 27.6625 21.9 34-35 22.8 28.287499999999998 26.6625 22.25 36-37 21.75 28.749999999999996 27.037499999999998 22.4625 38-39 22.9875 27.9375 27.250000000000004 21.825 40-41 21.099999999999998 28.762500000000003 27.525 22.6125 42-43 20.9125 28.449999999999996 27.975 22.662499999999998 44-45 21.9375 28.125 27.287499999999998 22.650000000000002 46-47 21.875 27.85 27.0125 23.2625 48-49 21.6625 28.299999999999997 27.487499999999997 22.55 50-51 22.061030515257627 28.039019509754876 27.988994497248626 21.91095547773887 52-53 22.336168084042022 29.00200100050025 26.388194097048522 22.273636818409205 54-55 22.6875 27.150000000000002 27.962500000000002 22.2 56-57 22.275 28.037499999999998 28.025 21.6625 58-59 21.95 27.700000000000003 27.737499999999997 22.6125 60-61 21.099999999999998 28.0875 28.3875 22.425 62-63 21.987499999999997 27.375 28.175 22.4625 64-65 21.8875 27.3625 28.487499999999997 22.2625 66-67 21.5 28.275 27.775 22.45 68-69 21.925 28.5625 27.05 22.4625 70-71 21.987499999999997 28.325 27.525 22.162499999999998 72-73 22.075 28.799999999999997 26.5125 22.6125 74-75 21.4875 28.249999999999996 28.349999999999998 21.912499999999998 76-77 22.287499999999998 28.050000000000004 27.525 22.1375 78-79 21.9625 27.250000000000004 27.975 22.8125 80-81 21.712500000000002 28.525 27.537499999999998 22.225 82-83 21.8 28.4125 27.825 21.9625 84-85 21.525 28.025 28.0875 22.3625 86-87 21.8625 28.549999999999997 28.1 21.4875 88-89 22.564102564102566 27.4671669793621 27.904940587867415 22.063789868667918 90-91 22.191643732799598 28.458844133099824 27.583187390542907 21.766324743557668 92-93 21.98324371639365 27.672877328998375 28.94835563336251 21.395523321245467 94-95 21.9375 27.150000000000002 28.6625 22.25 96-97 21.987499999999997 27.55 28.262500000000003 22.2 98-99 22.9875 27.55 27.925 21.5375 100 22.8 28.375 28.050000000000004 20.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 1.0 25 2.0 26 2.0 27 4.5 28 8.0 29 9.0 30 15.5 31 24.0 32 28.0 33 37.0 34 53.5 35 57.5 36 85.5 37 124.0 38 138.0 39 167.5 40 195.0 41 221.5 42 243.0 43 256.0 44 268.0 45 278.0 46 266.0 47 231.0 48 208.0 49 206.5 50 189.0 51 148.0 52 122.0 53 96.5 54 74.0 55 56.5 56 45.5 57 34.5 58 19.5 59 17.0 60 14.0 61 9.5 62 10.0 63 7.5 64 5.0 65 4.0 66 2.0 67 1.0 68 1.5 69 2.0 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 1.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.05 52-53 0.05 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0625 90-91 0.075 92-93 0.0375 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2508151492350138 0.5 3 0.0 0.0 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889476 spots for SRR3207874.sra Written 889476 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra Read 889461 spots for SRR3207874.sra Written 889461 spots for SRR3207874.sra SRR ids: ['SRR3207874.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7b5sasn7 SRR3207874.sra spots: 17789235 blocks: [[1, 889461], [889462, 1778922], [1778923, 2668383], [2668384, 3557844], [3557845, 4447305], [4447306, 5336766], [5336767, 6226227], [6226228, 7115688], [7115689, 8005149], [8005150, 8894610], [8894611, 9784071], [9784072, 10673532], [10673533, 11562993], [11562994, 12452454], [12452455, 13341915], [13341916, 14231376], [14231377, 15120837], [15120838, 16010298], [16010299, 16899759], [16899760, 17789235]] SRR3207874 file size 4618643 SRR3207874 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207874 SRR3207874_1.fastq Input file: SRR3207874_1.fastq trimmed: SRR3207874-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:52:00 2025 >> started Tue Feb 11 10:52:13 2025 >> done (13.124s) 17789235 reads processed; of these: 2837 ( 0.02%) short reads filtered out after trimming by size control 32549 ( 0.18%) empty reads filtered out after trimming by size control 17753849 (99.80%) reads available; of these: 1560555 ( 8.79%) trimmed reads available after processing 16193294 (91.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 506 0.00% 19 581 0.00% 20 738 0.00% 21 1015 0.01% 22 1297 0.01% 23 1748 0.01% 24 2275 0.01% 25 3086 0.02% 26 2962 0.02% 27 2977 0.02% 28 3044 0.02% 29 3070 0.02% 30 3068 0.02% 31 3113 0.02% 32 3090 0.02% 33 3264 0.02% 34 3590 0.02% 35 3725 0.02% 36 3971 0.02% 37 4299 0.02% 38 4643 0.03% 39 4735 0.03% 40 5159 0.03% 41 5320 0.03% 42 5709 0.03% 43 5968 0.03% 44 6211 0.03% 45 6691 0.04% 46 6938 0.04% 47 7303 0.04% 48 7841 0.04% 49 8304 0.05% 50 8814 0.05% 51 9116 0.05% 52 9188 0.05% 53 9774 0.06% 54 10642 0.06% 55 11341 0.06% 56 11939 0.07% 57 11834 0.07% 58 12404 0.07% 59 12292 0.07% 60 12648 0.07% 61 12580 0.07% 62 13089 0.07% 63 13073 0.07% 64 13390 0.08% 65 13607 0.08% 66 13532 0.08% 67 13853 0.08% 68 14509 0.08% 69 14633 0.08% 70 14722 0.08% 71 15447 0.09% 72 15509 0.09% 73 15879 0.09% 74 16311 0.09% 75 15671 0.09% 76 11359 0.06% 77 13173 0.07% 78 14898 0.08% 79 16315 0.09% 80 17945 0.10% 81 19359 0.11% 82 20775 0.12% 83 23099 0.13% 84 23447 0.13% 85 25594 0.14% 86 27539 0.16% 87 31257 0.18% 88 32406 0.18% 89 35235 0.20% 90 39301 0.22% 91 43126 0.24% 92 49416 0.28% 93 56992 0.32% 94 67092 0.38% 95 77171 0.43% 96 93252 0.53% 97 108799 0.61% 98 124281 0.70% 99 126686 0.71% 100 16193294 91.21% 17753849 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=11.49 fanout-score-rank=12 prefix-density=0.07 prefix-fanout=11.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=280.98 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=29.5 sequence=TTCTTCTTCTTT Started job on | Feb 11 10:52:31 Started mapping on | Feb 11 10:52:31 Finished on | Feb 11 10:52:51 Mapping speed, Million of reads per hour | 3195.69 Number of input reads | 17753849 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 16936404 Uniquely mapped reads % | 95.40% Average mapped length | 98.19 Number of splices: Total | 4786514 Number of splices: Annotated (sjdb) | 4698672 Number of splices: GT/AG | 4710353 Number of splices: GC/AG | 62605 Number of splices: AT/AC | 5479 Number of splices: Non-canonical | 8077 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449399 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 203052 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 368046 368046 368046 N_multimapping 449399 449399 449399 N_noFeature 668866 8683695 8797697 N_ambiguous 183289 29929 29722 UnstrandedReadsAssigned:16084249 PositiveStrandReadsAssigned:8222780 NegativeStrandReadsAssigned:8108985 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207874 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207874-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,753,849 reads, 16,614,462 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52401 SRR3207874.ke.tsv 34699 SRR3207874.se.tsv 87100 total ==> SRR3207874.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 725 31.7319 Potri.005G024800.1.v4.1 1035 936 164 14.7164 Potri.004G059700.1.v4.1 961 862 42 4.09237 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 460.781 13.6081 Potri.016G087400.1.v4.1 270 171 759 372.802 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 59 2.96025 Potri.012G127500.1.v4.1 977 878 2991 286.124 ==> SRR3207874.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1856 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 51 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207874 completed mapping pipeline successfully