Starting /dee2/code/volunteer_pipeline.sh SRR3207875 current disk space = 3052698554368 free memory = 1405747124 SRR3207875 SRAfilesize 8970086f7432aa102844629d384fab9f SRR3207875.sra SRR3207875.sra file validated SRR3207875 is single end SRR3207875 is conventional basespace SRR3207875 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207875_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98475 34.0 33.0 34.0 31.0 34.0 2 33.2095 34.0 34.0 34.0 31.0 34.0 3 33.33675 34.0 34.0 34.0 31.0 34.0 4 36.56675 37.0 37.0 37.0 35.0 37.0 5 36.57575 37.0 37.0 37.0 35.0 37.0 6 36.518 37.0 37.0 37.0 35.0 37.0 7 36.52 37.0 37.0 37.0 35.0 37.0 8 36.4985 37.0 37.0 37.0 35.0 37.0 9 38.36125 39.0 39.0 39.0 37.0 39.0 10-11 38.361125 39.0 39.0 39.0 37.0 39.0 12-13 38.304249999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.923249999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.856875 41.0 40.0 41.0 38.0 41.0 18-19 39.713375 41.0 40.0 41.0 37.0 41.0 20-21 39.654624999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.40025 41.0 39.5 41.0 36.5 41.0 24-25 39.494125 41.0 39.5 41.0 36.5 41.0 26-27 39.363749999999996 41.0 39.0 41.0 36.5 41.0 28-29 39.26975 41.0 39.0 41.0 36.0 41.0 30-31 39.03525 41.0 39.0 41.0 35.5 41.0 32-33 39.251 41.0 39.0 41.0 36.0 41.0 34-35 39.291875000000005 41.0 39.5 41.0 36.5 41.0 36-37 39.3245 41.0 40.0 41.0 36.5 41.0 38-39 39.019875 41.0 39.0 41.0 35.5 41.0 40-41 38.928375 40.5 39.0 41.0 35.0 41.0 42-43 39.151624999999996 41.0 39.0 41.0 36.0 41.0 44-45 39.077875 41.0 39.0 41.0 35.5 41.0 46-47 38.84075 40.5 39.0 41.0 35.5 41.0 48-49 38.740625 40.5 39.0 41.0 35.0 41.0 50-51 38.617000000000004 40.0 39.0 41.0 34.5 41.0 52-53 38.660624999999996 40.0 39.0 41.0 35.0 41.0 54-55 38.533874999999995 40.0 38.0 41.0 34.5 41.0 56-57 38.44475 40.0 38.0 41.0 34.5 41.0 58-59 38.098875 40.0 38.0 41.0 33.5 41.0 60-61 37.58075 40.0 37.0 41.0 32.5 41.0 62-63 37.561125000000004 39.5 37.0 41.0 33.0 41.0 64-65 37.183 39.0 36.0 41.0 32.5 41.0 66-67 36.94 39.0 36.0 40.0 32.0 41.0 68-69 36.569874999999996 38.0 35.5 40.0 32.0 41.0 70-71 35.91075 37.0 35.0 39.5 31.0 41.0 72-73 35.452375 37.0 35.0 39.0 31.0 40.5 74-75 35.05 36.5 34.5 39.0 30.5 40.0 76-77 33.987625 35.0 33.5 37.0 29.5 39.0 78-79 34.031875 35.0 34.0 37.0 30.0 39.0 80-81 34.09462499999999 35.0 34.0 37.0 31.0 38.5 82-83 33.822125 35.0 34.0 36.0 31.0 37.0 84-85 33.4735 35.0 34.0 36.0 30.0 37.0 86-87 33.031 35.0 34.0 35.5 29.5 36.5 88-89 32.70725 35.0 34.0 35.0 29.0 36.0 90-91 32.660624999999996 35.0 34.0 35.0 29.0 36.0 92-93 32.328875 35.0 33.5 35.0 28.0 36.0 94-95 32.238875 35.0 33.0 35.0 29.0 35.0 96-97 32.101124999999996 35.0 33.0 35.0 29.0 35.0 98-99 32.002250000000004 35.0 33.0 35.0 28.5 35.0 100 31.794 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 2.0 11 0.0 12 5.0 13 7.0 14 2.0 15 7.0 16 4.0 17 11.0 18 7.0 19 11.0 20 8.0 21 11.0 22 11.0 23 14.0 24 13.0 25 11.0 26 14.0 27 20.0 28 17.0 29 24.0 30 36.0 31 48.0 32 64.0 33 90.0 34 119.0 35 157.0 36 314.0 37 881.0 38 1734.0 39 355.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.244343891402718 17.194570135746606 12.719959778783307 43.84112619406737 2 19.5 23.575 37.6 19.325 3 21.45 25.2 27.325 26.025 4 24.55 31.3 21.4 22.75 5 25.656414103525883 35.08377094273568 21.880470117529384 17.37934483620905 6 19.75 37.95 24.5 17.8 7 16.625 22.15 41.949999999999996 19.275000000000002 8 19.125 24.575 32.0 24.3 9 19.8 24.575 32.375 23.25 10-11 21.637500000000003 34.2625 24.7375 19.3625 12-13 20.3 28.475 29.1875 22.037499999999998 14-15 20.0375 29.4125 28.9125 21.637500000000003 16-17 22.45 27.787499999999998 28.6875 21.075 18-19 21.6 29.7875 27.537499999999998 21.075 20-21 21.975 29.9375 27.5125 20.575 22-23 20.875 29.349999999999998 29.2875 20.4875 24-25 21.05 28.7375 29.1375 21.075 26-27 21.125 29.799999999999997 28.6625 20.4125 28-29 20.5125 29.475 28.237499999999997 21.775 30-31 20.5625 29.45 28.3875 21.6 32-33 21.349999999999998 29.15 28.425 21.075 34-35 21.1875 29.15 28.287499999999998 21.375 36-37 20.9375 30.349999999999998 27.950000000000003 20.7625 38-39 21.2 31.087500000000002 27.5125 20.200000000000003 40-41 20.625 29.562500000000004 28.050000000000004 21.762500000000003 42-43 20.325 29.6375 28.675 21.3625 44-45 21.4 29.1125 28.1875 21.3 46-47 21.087500000000002 28.825 28.299999999999997 21.7875 48-49 19.975 28.962500000000002 30.25 20.8125 50-51 21.46073036518259 29.539769884942473 28.001500750375186 20.99799899949975 52-53 20.597798899449725 29.277138569284645 29.264632316158078 20.860430215107552 54-55 20.5875 29.7875 28.975 20.65 56-57 21.55 29.212500000000002 28.1875 21.05 58-59 21.087500000000002 28.775000000000002 28.9 21.2375 60-61 21.125 29.1625 28.8625 20.849999999999998 62-63 21.175 28.5625 28.8375 21.425 64-65 21.75 29.4375 28.275 20.5375 66-67 20.7375 28.762500000000003 28.962500000000002 21.5375 68-69 21.45 29.362500000000004 28.225 20.962500000000002 70-71 21.725 29.1875 28.6875 20.4 72-73 20.5375 28.9 29.312500000000004 21.25 74-75 21.5625 28.475 28.6125 21.349999999999998 76-77 21.2875 29.9375 27.500000000000004 21.275 78-79 21.325 29.2375 28.4375 21.0 80-81 22.402800350043755 28.766095761970245 28.053506688336043 20.777597199649954 82-83 20.974999999999998 29.062500000000004 28.3875 21.575 84-85 22.380595148787197 27.969492373093274 28.66966741685421 20.980245061265315 86-87 20.980245061265315 29.182295573893473 29.43235808952238 20.40510127531883 88-89 21.128346259694773 29.034275706780083 28.784088066049534 21.053289967475607 90-91 21.66896034029776 29.35068184661579 29.175528587514076 19.804829225572377 92-93 21.90392794595947 28.646484863647736 29.09682261696272 20.352764573430076 94-95 21.12042015755908 29.048393147430286 28.648243091159188 21.182943603851445 96-97 21.680420105026258 28.60715178794699 29.732433108277068 19.979994998749685 98-99 21.608103038639488 28.398149305989744 28.83581343003626 21.1579342253345 100 21.224999999999998 28.15 29.349999999999998 21.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 2.0 23 3.5 24 3.5 25 3.0 26 5.5 27 10.0 28 14.5 29 19.0 30 20.5 31 33.5 32 44.5 33 55.0 34 77.0 35 107.5 36 138.5 37 161.5 38 179.0 39 203.5 40 218.0 41 255.0 42 291.0 43 284.5 44 282.5 45 268.0 46 244.0 47 220.5 48 189.0 49 148.0 50 122.5 51 106.0 52 82.0 53 60.0 54 42.0 55 27.0 56 22.0 57 16.5 58 11.0 59 9.0 60 3.5 61 1.5 62 1.0 63 2.0 64 1.5 65 0.5 66 1.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.05 52-53 0.05 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.025 86-87 0.025 88-89 0.075 90-91 0.08750000000000001 92-93 0.075 94-95 0.0375 96-97 0.025 98-99 0.0375 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995189 spots for SRR3207875.sra Written 995189 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra Read 995180 spots for SRR3207875.sra Written 995180 spots for SRR3207875.sra SRR ids: ['SRR3207875.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4kz3mnv3 SRR3207875.sra spots: 19903609 blocks: [[1, 995180], [995181, 1990360], [1990361, 2985540], [2985541, 3980720], [3980721, 4975900], [4975901, 5971080], [5971081, 6966260], [6966261, 7961440], [7961441, 8956620], [8956621, 9951800], [9951801, 10946980], [10946981, 11942160], [11942161, 12937340], [12937341, 13932520], [13932521, 14927700], [14927701, 15922880], [15922881, 16918060], [16918061, 17913240], [17913241, 18908420], [18908421, 19903609]] SRR3207875 file size 5168900 SRR3207875 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207875 SRR3207875_1.fastq Input file: SRR3207875_1.fastq trimmed: SRR3207875-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:54:23 2025 >> started Tue Feb 11 10:54:33 2025 >> done (10.224s) 19903609 reads processed; of these: 1279 ( 0.01%) short reads filtered out after trimming by size control 13116 ( 0.07%) empty reads filtered out after trimming by size control 19889214 (99.93%) reads available; of these: 1539594 ( 7.74%) trimmed reads available after processing 18349620 (92.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 379 0.00% 19 448 0.00% 20 612 0.00% 21 885 0.00% 22 1372 0.01% 23 1794 0.01% 24 2258 0.01% 25 3214 0.02% 26 3036 0.02% 27 3013 0.02% 28 3104 0.02% 29 3069 0.02% 30 3029 0.02% 31 3083 0.02% 32 3159 0.02% 33 3260 0.02% 34 3512 0.02% 35 3707 0.02% 36 4004 0.02% 37 4167 0.02% 38 4585 0.02% 39 4804 0.02% 40 4945 0.02% 41 5191 0.03% 42 5500 0.03% 43 5893 0.03% 44 6156 0.03% 45 6308 0.03% 46 6631 0.03% 47 7121 0.04% 48 7719 0.04% 49 7792 0.04% 50 8400 0.04% 51 8622 0.04% 52 9049 0.05% 53 9713 0.05% 54 10434 0.05% 55 10771 0.05% 56 11403 0.06% 57 11649 0.06% 58 12031 0.06% 59 12055 0.06% 60 12311 0.06% 61 12343 0.06% 62 12542 0.06% 63 12493 0.06% 64 12703 0.06% 65 13021 0.07% 66 13126 0.07% 67 13369 0.07% 68 13729 0.07% 69 14323 0.07% 70 14254 0.07% 71 14756 0.07% 72 15434 0.08% 73 15577 0.08% 74 16054 0.08% 75 15967 0.08% 76 11352 0.06% 77 13155 0.07% 78 14777 0.07% 79 16350 0.08% 80 18037 0.09% 81 19039 0.10% 82 20455 0.10% 83 22850 0.11% 84 23358 0.12% 85 25236 0.13% 86 27370 0.14% 87 30586 0.15% 88 31849 0.16% 89 34565 0.17% 90 38951 0.20% 91 42833 0.22% 92 48927 0.25% 93 56551 0.28% 94 66194 0.33% 95 76652 0.39% 96 91926 0.46% 97 107356 0.54% 98 124431 0.63% 99 126915 0.64% 100 18349620 92.26% 19889214 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=37 prefix-density=0.01 prefix-fanout=2.0 sequence=TCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=315.40 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=23.7 sequence=AAGAAGAAGAAG Started job on | Feb 11 10:54:53 Started mapping on | Feb 11 10:54:53 Finished on | Feb 11 10:55:13 Mapping speed, Million of reads per hour | 3580.06 Number of input reads | 19889214 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19061589 Uniquely mapped reads % | 95.84% Average mapped length | 98.39 Number of splices: Total | 5034783 Number of splices: Annotated (sjdb) | 4924134 Number of splices: GT/AG | 4953349 Number of splices: GC/AG | 66447 Number of splices: AT/AC | 5548 Number of splices: Non-canonical | 9439 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443887 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 102352 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.40% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 383738 383738 383738 N_multimapping 443887 443887 443887 N_noFeature 1069450 9944182 10041011 N_ambiguous 215913 35016 35509 UnstrandedReadsAssigned:17776226 PositiveStrandReadsAssigned:9082391 NegativeStrandReadsAssigned:8985069 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207875 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207875-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,889,214 reads, 18,167,991 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52401 SRR3207875.ke.tsv 34699 SRR3207875.se.tsv 87100 total ==> SRR3207875.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1111 43.3531 Potri.005G024800.1.v4.1 1035 936 457 36.5613 Potri.004G059700.1.v4.1 961 862 64 5.55973 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 459.654 12.1027 Potri.016G087400.1.v4.1 270 171 684 299.53 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 58 2.5945 Potri.012G127500.1.v4.1 977 878 3224 274.967 ==> SRR3207875.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2239 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 345 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207875 completed mapping pipeline successfully