Starting /dee2/code/volunteer_pipeline.sh SRR3207876 current disk space = 3052631109632 free memory = 1454877232 SRR3207876 SRAfilesize af698d3fdc253cb57fc6b9b9e37cc8b9 SRR3207876.sra SRR3207876.sra file validated SRR3207876 is single end SRR3207876 is conventional basespace SRR3207876 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207876_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8515 34.0 33.0 34.0 31.0 34.0 2 33.13 34.0 34.0 34.0 31.0 34.0 3 33.294 34.0 34.0 34.0 31.0 34.0 4 36.57325 37.0 37.0 37.0 35.0 37.0 5 36.52875 37.0 37.0 37.0 35.0 37.0 6 36.519 37.0 37.0 37.0 35.0 37.0 7 36.5135 37.0 37.0 37.0 35.0 37.0 8 36.5095 37.0 37.0 37.0 35.0 37.0 9 38.3925 39.0 39.0 39.0 37.0 39.0 10-11 38.354124999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.272625000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.792500000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.741875 41.0 40.0 41.0 37.5 41.0 18-19 39.557375 41.0 40.0 41.0 37.0 41.0 20-21 39.491 41.0 39.5 41.0 37.0 41.0 22-23 39.34975 41.0 39.0 41.0 36.5 41.0 24-25 39.324625 41.0 39.0 41.0 36.0 41.0 26-27 39.074875 41.0 39.0 41.0 36.0 41.0 28-29 39.024375000000006 41.0 39.0 41.0 36.0 41.0 30-31 38.714625 40.0 38.0 41.0 34.5 41.0 32-33 38.97624999999999 41.0 39.0 41.0 35.5 41.0 34-35 38.983125 41.0 39.0 41.0 35.0 41.0 36-37 38.961625 41.0 39.0 41.0 35.0 41.0 38-39 38.5095 40.5 38.0 41.0 34.5 41.0 40-41 38.46725 40.0 38.0 41.0 34.0 41.0 42-43 38.60575 40.0 38.0 41.0 34.5 41.0 44-45 38.4125 40.0 38.0 41.0 34.0 41.0 46-47 38.170874999999995 40.0 38.0 41.0 33.5 41.0 48-49 37.972875 40.0 37.5 41.0 33.0 41.0 50-51 37.740875 40.0 37.0 41.0 33.0 41.0 52-53 37.854124999999996 40.0 37.0 41.0 33.0 41.0 54-55 37.685500000000005 40.0 36.5 41.0 33.0 41.0 56-57 37.55025 40.0 36.0 41.0 33.0 41.0 58-59 37.023375 39.5 35.5 41.0 32.0 41.0 60-61 36.573750000000004 39.0 35.0 41.0 31.0 41.0 62-63 36.420875 39.0 35.0 40.5 31.0 41.0 64-65 36.10775 38.0 35.0 40.0 31.0 41.0 66-67 35.79575 37.0 35.0 40.0 31.0 41.0 68-69 35.373 37.0 35.0 39.5 30.0 41.0 70-71 34.777874999999995 36.0 34.0 39.0 29.0 40.5 72-73 34.161874999999995 35.5 34.0 38.5 28.0 40.0 74-75 33.90575 35.0 34.0 37.0 28.5 39.5 76-77 32.911874999999995 34.5 32.5 36.0 27.5 39.0 78-79 33.1105 35.0 33.5 36.0 28.0 38.5 80-81 33.18475 35.0 34.0 36.0 29.0 37.0 82-83 32.96875 35.0 34.0 36.0 29.0 37.0 84-85 32.686 35.0 34.0 35.0 29.0 36.5 86-87 32.273 35.0 33.0 35.0 26.5 36.0 88-89 31.993375 35.0 33.0 35.0 26.0 36.0 90-91 31.9195 35.0 33.0 35.0 26.0 36.0 92-93 31.613374999999998 35.0 33.0 35.0 25.0 35.0 94-95 31.56575 35.0 33.0 35.0 25.5 35.0 96-97 31.28725 35.0 33.0 35.0 25.0 35.0 98-99 31.074624999999997 35.0 32.0 35.0 24.5 35.0 100 30.771 34.0 32.0 35.0 22.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 2.0 8 3.0 9 1.0 10 1.0 11 6.0 12 8.0 13 4.0 14 7.0 15 9.0 16 9.0 17 9.0 18 9.0 19 14.0 20 11.0 21 10.0 22 13.0 23 10.0 24 13.0 25 24.0 26 26.0 27 31.0 28 30.0 29 31.0 30 50.0 31 57.0 32 63.0 33 114.0 34 156.0 35 253.0 36 426.0 37 934.0 38 1416.0 39 246.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.241492311570457 15.452482984623142 12.830854550037813 45.47517015376859 2 21.125 21.325 35.65 21.9 3 22.975 24.25 25.25 27.525 4 25.124999999999996 31.2 19.1 24.575 5 26.224999999999998 32.6 21.9 19.275000000000002 6 21.55 36.4 22.275 19.775000000000002 7 18.125 20.599999999999998 40.175 21.099999999999998 8 19.650000000000002 22.7 29.825000000000003 27.825 9 20.849999999999998 23.549999999999997 30.0 25.6 10-11 23.7625 32.1875 22.6125 21.4375 12-13 21.7 26.700000000000003 27.5875 24.0125 14-15 21.5625 27.1625 27.962500000000002 23.3125 16-17 23.3 26.900000000000002 26.625 23.175 18-19 23.849999999999998 27.0 26.1625 22.9875 20-21 23.1625 27.0625 26.825 22.95 22-23 22.075 27.287499999999998 27.6 23.0375 24-25 22.1875 27.725 26.650000000000002 23.4375 26-27 22.325 27.950000000000003 26.35 23.375 28-29 22.9875 28.037499999999998 26.625 22.35 30-31 23.025000000000002 26.987499999999997 27.375 22.6125 32-33 23.7 26.5625 26.450000000000003 23.2875 34-35 22.675 26.5875 26.825 23.9125 36-37 23.0375 27.0 27.1 22.8625 38-39 22.0 27.725 27.0875 23.1875 40-41 22.9875 27.700000000000003 26.025 23.2875 42-43 22.25 27.962500000000002 26.737499999999997 23.05 44-45 23.599999999999998 26.6625 26.75 22.9875 46-47 22.900000000000002 26.724999999999998 26.924999999999997 23.45 48-49 22.85 26.375 27.287499999999998 23.4875 50-51 22.696011004126547 28.160560210078778 25.5220707765412 23.62135800925347 52-53 23.783918969613605 27.72289608603226 26.19732399649869 22.295860947855445 54-55 23.3125 27.975 25.674999999999997 23.0375 56-57 22.7125 27.6625 27.1125 22.5125 58-59 23.1375 27.1625 27.3375 22.3625 60-61 22.8 27.425 26.5375 23.2375 62-63 23.6375 26.75 26.937499999999996 22.675 64-65 22.6875 27.275 26.7125 23.325000000000003 66-67 23.4625 27.212500000000002 26.0 23.325000000000003 68-69 24.275 27.55 26.900000000000002 21.275 70-71 23.45 26.55 27.575 22.425 72-73 23.974999999999998 26.487500000000004 27.0625 22.475 74-75 23.65 26.974999999999998 27.1125 22.2625 76-77 24.275 26.9625 26.137500000000003 22.625 78-79 22.725 26.700000000000003 26.9625 23.6125 80-81 23.275000000000002 27.950000000000003 26.525 22.25 82-83 22.287499999999998 27.0875 27.125 23.5 84-85 23.090386298287285 27.428428553569194 26.128266033254157 23.35291911488936 86-87 24.065508188523566 26.478309788723593 26.153269158644832 23.302912864108013 88-89 23.261630815407706 27.37618809404702 27.088544272136065 22.273636818409205 90-91 23.88694347173587 26.138069034517258 26.975987993997 22.998999499749875 92-93 23.23371264224084 27.785419532324624 25.997248968363134 22.983618857071402 94-95 23.400000000000002 26.9625 27.5125 22.125 96-97 22.775000000000002 27.55 26.3625 23.3125 98-99 23.0375 27.187499999999996 27.4125 22.3625 100 24.075 26.85 25.575 23.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 2.5 25 2.5 26 2.5 27 3.5 28 4.5 29 7.0 30 12.5 31 14.0 32 21.5 33 36.5 34 43.5 35 52.5 36 74.0 37 98.0 38 121.0 39 144.0 40 178.0 41 206.0 42 205.0 43 214.0 44 243.5 45 248.0 46 230.5 47 224.0 48 223.0 49 203.0 50 158.5 51 118.5 52 119.5 53 123.5 54 103.0 55 72.5 56 49.5 57 47.0 58 50.0 59 47.5 60 42.0 61 37.5 62 30.0 63 23.0 64 20.5 65 17.5 66 11.5 67 11.0 68 11.5 69 9.5 70 6.5 71 7.0 72 7.5 73 12.0 74 11.0 75 8.5 76 10.0 77 5.0 78 3.5 79 2.5 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0375 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.0125 88-89 0.05 90-91 0.05 92-93 0.0375 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44902110348335 96.8 2 1.398423595219934 2.75 3 0.15255530129672007 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312809 spots for SRR3207876.sra Written 1312809 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra Read 1312801 spots for SRR3207876.sra Written 1312801 spots for SRR3207876.sra SRR ids: ['SRR3207876.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4cz4erlg SRR3207876.sra spots: 26256028 blocks: [[1, 1312801], [1312802, 2625602], [2625603, 3938403], [3938404, 5251204], [5251205, 6564005], [6564006, 7876806], [7876807, 9189607], [9189608, 10502408], [10502409, 11815209], [11815210, 13128010], [13128011, 14440811], [14440812, 15753612], [15753613, 17066413], [17066414, 18379214], [18379215, 19692015], [19692016, 21004816], [21004817, 22317617], [22317618, 23630418], [23630419, 24943219], [24943220, 26256028]] SRR3207876 file size 6822051 SRR3207876 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207876 SRR3207876_1.fastq Input file: SRR3207876_1.fastq trimmed: SRR3207876-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 10:58:40 2025 >> started Tue Feb 11 10:58:53 2025 >> done (13.108s) 26256028 reads processed; of these: 4858 ( 0.02%) short reads filtered out after trimming by size control 34780 ( 0.13%) empty reads filtered out after trimming by size control 26216390 (99.85%) reads available; of these: 2666592 (10.17%) trimmed reads available after processing 23549798 (89.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1000 0.00% 19 1160 0.00% 20 1517 0.01% 21 1924 0.01% 22 2561 0.01% 23 3448 0.01% 24 4240 0.02% 25 5950 0.02% 26 5613 0.02% 27 5782 0.02% 28 5739 0.02% 29 5723 0.02% 30 6027 0.02% 31 5905 0.02% 32 6172 0.02% 33 6407 0.02% 34 6914 0.03% 35 7461 0.03% 36 8384 0.03% 37 8387 0.03% 38 9103 0.03% 39 9567 0.04% 40 9829 0.04% 41 10328 0.04% 42 10900 0.04% 43 11756 0.04% 44 11989 0.05% 45 12428 0.05% 46 12701 0.05% 47 13715 0.05% 48 14478 0.06% 49 14977 0.06% 50 15716 0.06% 51 15974 0.06% 52 16533 0.06% 53 17234 0.07% 54 19318 0.07% 55 19809 0.08% 56 20930 0.08% 57 21004 0.08% 58 21561 0.08% 59 21395 0.08% 60 22161 0.08% 61 21801 0.08% 62 22793 0.09% 63 22326 0.09% 64 22596 0.09% 65 23400 0.09% 66 23199 0.09% 67 23824 0.09% 68 24806 0.09% 69 25067 0.10% 70 25117 0.10% 71 26444 0.10% 72 26161 0.10% 73 26935 0.10% 74 27020 0.10% 75 27186 0.10% 76 18692 0.07% 77 21527 0.08% 78 25568 0.10% 79 27321 0.10% 80 29937 0.11% 81 32568 0.12% 82 35899 0.14% 83 39264 0.15% 84 39910 0.15% 85 43971 0.17% 86 46675 0.18% 87 52878 0.20% 88 55862 0.21% 89 61971 0.24% 90 67586 0.26% 91 73641 0.28% 92 85135 0.32% 93 97102 0.37% 94 112525 0.43% 95 131558 0.50% 96 154497 0.59% 97 179826 0.69% 98 203223 0.78% 99 207061 0.79% 100 23549798 89.83% 26216390 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=31 prefix-density=0.35 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=229.23 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=25.9 sequence=AAGAAGAAGAAA Started job on | Feb 11 10:59:12 Started mapping on | Feb 11 10:59:12 Finished on | Feb 11 10:59:52 Mapping speed, Million of reads per hour | 2359.48 Number of input reads | 26216390 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20366219 Uniquely mapped reads % | 77.69% Average mapped length | 98.22 Number of splices: Total | 5644717 Number of splices: Annotated (sjdb) | 5534156 Number of splices: GT/AG | 5552505 Number of splices: GC/AG | 75765 Number of splices: AT/AC | 6411 Number of splices: Non-canonical | 10036 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 733393 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 4606909 % of reads mapped to too many loci | 17.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5116778 5116778 5116778 N_multimapping 733393 733393 733393 N_noFeature 869027 10476407 10600808 N_ambiguous 230460 36595 36229 UnstrandedReadsAssigned:19266732 PositiveStrandReadsAssigned:9853217 NegativeStrandReadsAssigned:9729182 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207876 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207876-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,216,390 reads, 24,005,112 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,264 rounds 52401 SRR3207876.ke.tsv 34699 SRR3207876.se.tsv 87100 total ==> SRR3207876.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1306 35.3068 Potri.005G024800.1.v4.1 1035 936 402 22.2813 Potri.004G059700.1.v4.1 961 862 69 4.15272 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 541.794 9.88315 Potri.016G087400.1.v4.1 270 171 861 261.215 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 52 1.61153 Potri.012G127500.1.v4.1 977 878 2300 135.901 ==> SRR3207876.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1483 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 28 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR3207876 completed mapping pipeline successfully