Starting /dee2/code/volunteer_pipeline.sh SRR3207877 current disk space = 3052425097216 free memory = 1505100372 SRR3207877 SRAfilesize 9d573d451f461c69fc61539a21c516cc SRR3207877.sra SRR3207877.sra file validated SRR3207877 is single end SRR3207877 is conventional basespace SRR3207877 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207877_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.858 34.0 33.0 34.0 31.0 34.0 2 33.15825 34.0 34.0 34.0 31.0 34.0 3 33.35425 34.0 34.0 34.0 31.0 34.0 4 36.60175 37.0 37.0 37.0 35.0 37.0 5 36.55975 37.0 37.0 37.0 35.0 37.0 6 36.624 37.0 37.0 37.0 35.0 37.0 7 36.5995 37.0 37.0 37.0 35.0 37.0 8 36.60125 37.0 37.0 37.0 35.0 37.0 9 38.57725 39.0 39.0 39.0 38.0 39.0 10-11 38.289 39.0 39.0 39.0 37.0 39.0 12-13 38.387 39.0 39.0 39.0 37.0 39.0 14-15 40.0305 41.0 40.0 41.0 38.0 41.0 16-17 40.024249999999995 41.0 40.0 41.0 38.0 41.0 18-19 40.060625 41.0 40.0 41.0 38.0 41.0 20-21 39.9985 41.0 40.0 41.0 38.0 41.0 22-23 39.961375000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.841875 41.0 40.0 41.0 37.5 41.0 26-27 39.91525 41.0 40.0 41.0 38.0 41.0 28-29 39.810125 41.0 40.0 41.0 38.0 41.0 30-31 39.55375 41.0 40.0 41.0 37.0 41.0 32-33 39.758250000000004 41.0 40.0 41.0 38.0 41.0 34-35 39.807625 41.0 40.0 41.0 38.0 41.0 36-37 39.741125 41.0 40.0 41.0 38.0 41.0 38-39 39.6215 41.0 40.0 41.0 37.0 41.0 40-41 39.625375 41.0 40.0 41.0 37.5 41.0 42-43 39.479625 41.0 39.5 41.0 37.5 41.0 44-45 39.361125 41.0 39.5 41.0 37.0 41.0 46-47 39.274 41.0 39.5 41.0 36.5 41.0 48-49 39.340500000000006 41.0 39.0 41.0 36.5 41.0 50-51 39.104375 41.0 39.0 41.0 36.0 41.0 52-53 38.940125 40.0 39.0 41.0 35.5 41.0 54-55 38.91925 40.0 39.0 41.0 35.0 41.0 56-57 38.8685 40.0 38.5 41.0 35.0 41.0 58-59 38.528375 40.0 38.0 41.0 34.5 41.0 60-61 38.24125 40.0 37.5 41.0 34.5 41.0 62-63 38.0775 39.5 37.0 41.0 35.0 41.0 64-65 37.83825 39.0 36.5 41.0 34.0 41.0 66-67 37.494 39.0 36.0 40.5 34.0 41.0 68-69 37.09725 38.5 35.5 40.0 34.0 41.0 70-71 36.314499999999995 37.0 35.0 39.0 32.5 41.0 72-73 36.083375000000004 37.0 35.0 39.0 33.0 40.5 74-75 35.461375000000004 36.0 35.0 38.5 32.0 39.5 76-77 34.527 35.0 34.0 37.0 30.5 39.0 78-79 34.845 35.0 35.0 37.0 32.0 39.0 80-81 34.55175 35.0 35.0 36.5 32.0 38.0 82-83 34.288124999999994 35.0 34.5 36.0 32.0 37.0 84-85 34.03125 35.0 34.0 36.0 32.0 37.0 86-87 33.633750000000006 35.0 34.0 35.0 31.0 36.5 88-89 33.548625 35.0 34.0 35.0 31.0 36.0 90-91 33.273125 35.0 34.0 35.0 31.0 36.0 92-93 33.036 35.0 34.0 35.0 30.5 35.5 94-95 33.054625 35.0 34.0 35.0 31.0 35.0 96-97 32.882125 35.0 34.0 35.0 30.0 35.0 98-99 32.778125 35.0 34.0 35.0 30.5 35.0 100 32.64375 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 4.0 12 2.0 13 3.0 14 1.0 15 4.0 16 4.0 17 1.0 18 3.0 19 4.0 20 9.0 21 4.0 22 4.0 23 7.0 24 5.0 25 6.0 26 12.0 27 12.0 28 18.0 29 19.0 30 26.0 31 32.0 32 36.0 33 50.0 34 95.0 35 167.0 36 279.0 37 969.0 38 1869.0 39 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.408803440424997 14.292942069314446 15.583101441942828 41.71515304831773 2 19.7 22.45 34.725 23.125 3 22.525000000000002 24.775 26.674999999999997 26.025 4 25.15 30.85 20.474999999999998 23.525 5 25.55 35.0 21.525 17.925 6 19.875 37.8 22.7 19.625 7 16.625 20.150000000000002 42.0 21.224999999999998 8 19.275000000000002 26.1 29.2 25.424999999999997 9 20.849999999999998 23.599999999999998 31.5 24.05 10-11 21.675 35.725 23.0 19.6 12-13 20.4625 27.150000000000002 29.3375 23.05 14-15 20.925 28.299999999999997 28.225 22.55 16-17 21.75 28.3375 28.275 21.637500000000003 18-19 21.45 27.762500000000003 28.037499999999998 22.75 20-21 21.825 27.3125 28.625 22.237499999999997 22-23 22.325 29.2375 26.25 22.1875 24-25 21.875 28.825 27.275 22.025 26-27 21.8 27.8375 27.900000000000002 22.4625 28-29 21.7875 27.725 28.3375 22.15 30-31 21.1125 28.7375 28.075 22.075 32-33 21.1625 28.8875 26.924999999999997 23.025000000000002 34-35 21.637500000000003 28.1375 27.787499999999998 22.4375 36-37 20.7375 29.099999999999998 28.037499999999998 22.125 38-39 21.349999999999998 28.849999999999998 27.6625 22.1375 40-41 21.2625 28.000000000000004 28.287499999999998 22.45 42-43 21.825 28.6625 27.1 22.412499999999998 44-45 21.9 28.287499999999998 27.675 22.1375 46-47 22.425 28.925 26.6625 21.987499999999997 48-49 21.275 29.175 27.725 21.825 50-51 20.943325409733518 28.950331540097586 27.423995996496934 22.682347053671965 52-53 22.012263796771368 28.557126767613568 27.44337379551996 21.987235640095108 54-55 21.8625 28.6875 27.200000000000003 22.25 56-57 21.65 27.85 27.900000000000002 22.6 58-59 21.762500000000003 28.237499999999997 27.950000000000003 22.05 60-61 22.325 28.1875 28.499999999999996 20.9875 62-63 21.25 27.575 28.95 22.225 64-65 21.775 28.725 28.000000000000004 21.5 66-67 21.1625 28.499999999999996 28.4 21.9375 68-69 21.5375 28.787499999999998 28.0625 21.6125 70-71 22.0 28.712500000000002 27.425 21.8625 72-73 21.975 28.3875 27.675 21.9625 74-75 21.712500000000002 29.037499999999998 27.537499999999998 21.712500000000002 76-77 22.287499999999998 28.1 27.825 21.7875 78-79 21.95 28.825 27.987499999999997 21.2375 80-81 22.55 27.025 28.275 22.15 82-83 21.725 28.8375 27.725 21.712500000000002 84-85 21.4875 28.237499999999997 28.299999999999997 21.975 86-87 21.9679919979995 28.507126781695426 27.481870467616904 22.043010752688172 88-89 22.419617165019393 29.20055048167146 26.886025272113102 21.493807081196046 90-91 22.40020022525341 27.956451007383304 28.331873357527222 21.311475409836063 92-93 22.426516572858034 28.005003126954346 28.380237648530333 21.188242651657283 94-95 21.66791697924481 28.432108027006752 28.732183045761438 21.167791947987 96-97 22.623811905952977 28.55177588794397 27.52626313156578 21.298149074537267 98-99 21.76088044022011 28.489244622311155 28.339169584792394 21.410705352676338 100 21.5 28.775000000000002 27.900000000000002 21.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 3.0 25 4.5 26 2.0 27 4.0 28 7.5 29 11.0 30 15.0 31 27.0 32 41.0 33 40.0 34 51.0 35 78.5 36 95.0 37 113.0 38 141.5 39 174.0 40 207.5 41 232.0 42 256.5 43 268.0 44 267.0 45 265.0 46 261.0 47 253.0 48 216.0 49 186.5 50 168.0 51 143.0 52 120.5 53 95.5 54 71.5 55 44.0 56 24.5 57 21.5 58 20.5 59 13.0 60 8.5 61 7.0 62 7.0 63 8.0 64 5.5 65 5.5 66 5.5 67 2.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 1.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.08750000000000001 52-53 0.11249999999999999 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.025 88-89 0.08750000000000001 90-91 0.11249999999999999 92-93 0.0625 94-95 0.025 96-97 0.05 98-99 0.05 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962254 spots for SRR3207877.sra Written 2962254 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra Read 2962252 spots for SRR3207877.sra Written 2962252 spots for SRR3207877.sra SRR ids: ['SRR3207877.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hf4sajaw SRR3207877.sra spots: 59245042 blocks: [[1, 2962252], [2962253, 5924504], [5924505, 8886756], [8886757, 11849008], [11849009, 14811260], [14811261, 17773512], [17773513, 20735764], [20735765, 23698016], [23698017, 26660268], [26660269, 29622520], [29622521, 32584772], [32584773, 35547024], [35547025, 38509276], [38509277, 41471528], [41471529, 44433780], [44433781, 47396032], [47396033, 50358284], [50358285, 53320536], [53320537, 56282788], [56282789, 59245042]] SRR3207877 file size 15407094 SRR3207877 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207877 SRR3207877_1.fastq Input file: SRR3207877_1.fastq trimmed: SRR3207877-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:15:20 2025 >> started Tue Feb 11 11:15:53 2025 >> done (32.495s) 59245042 reads processed; of these: 8097 ( 0.01%) short reads filtered out after trimming by size control 37085 ( 0.06%) empty reads filtered out after trimming by size control 59199860 (99.92%) reads available; of these: 4578487 ( 7.73%) trimmed reads available after processing 54621373 (92.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1510 0.00% 19 1802 0.00% 20 2233 0.00% 21 2961 0.01% 22 4100 0.01% 23 5957 0.01% 24 7768 0.01% 25 10175 0.02% 26 10479 0.02% 27 10367 0.02% 28 10668 0.02% 29 10971 0.02% 30 10579 0.02% 31 10410 0.02% 32 10402 0.02% 33 10578 0.02% 34 11386 0.02% 35 11385 0.02% 36 12517 0.02% 37 12802 0.02% 38 13719 0.02% 39 14506 0.02% 40 15323 0.03% 41 15576 0.03% 42 16484 0.03% 43 17407 0.03% 44 18527 0.03% 45 18952 0.03% 46 20054 0.03% 47 21131 0.04% 48 22186 0.04% 49 23393 0.04% 50 24527 0.04% 51 25079 0.04% 52 26315 0.04% 53 27403 0.05% 54 29414 0.05% 55 30853 0.05% 56 32571 0.06% 57 33270 0.06% 58 34967 0.06% 59 35195 0.06% 60 35902 0.06% 61 36349 0.06% 62 37492 0.06% 63 37192 0.06% 64 37259 0.06% 65 38011 0.06% 66 38139 0.06% 67 39200 0.07% 68 40647 0.07% 69 40478 0.07% 70 40685 0.07% 71 41907 0.07% 72 43089 0.07% 73 44685 0.08% 74 44886 0.08% 75 43945 0.07% 76 32890 0.06% 77 37286 0.06% 78 42729 0.07% 79 47611 0.08% 80 51103 0.09% 81 55120 0.09% 82 59930 0.10% 83 66962 0.11% 84 68833 0.12% 85 76597 0.13% 86 82015 0.14% 87 87907 0.15% 88 94306 0.16% 89 99325 0.17% 90 111614 0.19% 91 127500 0.22% 92 146721 0.25% 93 169572 0.29% 94 217921 0.37% 95 273927 0.46% 96 269182 0.45% 97 312847 0.53% 98 352448 0.60% 99 368373 0.62% 100 54621373 92.27% 59199860 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=17.22 fanout-score-rank=10 prefix-density=0.11 prefix-fanout=17.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=18 fanout-score=284.13 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=29.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 11:16:10 Started mapping on | Feb 11 11:16:10 Finished on | Feb 11 11:17:05 Mapping speed, Million of reads per hour | 3874.90 Number of input reads | 59199860 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 56534717 Uniquely mapped reads % | 95.50% Average mapped length | 98.38 Number of splices: Total | 15256615 Number of splices: Annotated (sjdb) | 14959801 Number of splices: GT/AG | 15016108 Number of splices: GC/AG | 195990 Number of splices: AT/AC | 18203 Number of splices: Non-canonical | 26314 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 1.96 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1444578 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 628054 % of reads mapped to too many loci | 1.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.99% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1220565 1220565 1220565 N_multimapping 1444578 1444578 1444578 N_noFeature 2273253 28990016 29348913 N_ambiguous 673112 102595 102507 UnstrandedReadsAssigned:53588352 PositiveStrandReadsAssigned:27442106 NegativeStrandReadsAssigned:27083297 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207877 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207877-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 59,199,860 reads, 55,301,195 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,324 rounds 52401 SRR3207877.ke.tsv 34699 SRR3207877.se.tsv 87100 total ==> SRR3207877.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 4422.63 56.4015 Potri.005G024800.1.v4.1 1035 936 1171.03 30.6181 Potri.004G059700.1.v4.1 961 862 288 8.17656 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1501.1 12.9171 Potri.016G087400.1.v4.1 270 171 2771.45 396.64 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 170.63 2.49451 Potri.012G127500.1.v4.1 977 878 7790 217.134 ==> SRR3207877.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6612 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 1027 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 229 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR3207877 completed mapping pipeline successfully