Starting /dee2/code/volunteer_pipeline.sh SRR3207878 current disk space = 3051413344256 free memory = 1580045368 SRR3207878 SRAfilesize 7173a555c342485b74115b68cec21be2 SRR3207878.sra SRR3207878.sra file validated SRR3207878 is single end SRR3207878 is conventional basespace SRR3207878 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207878_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07775 34.0 33.0 34.0 31.0 34.0 2 33.231 34.0 34.0 34.0 31.0 34.0 3 33.359 34.0 34.0 34.0 31.0 34.0 4 36.6265 37.0 37.0 37.0 35.0 37.0 5 36.57675 37.0 37.0 37.0 35.0 37.0 6 36.644 37.0 37.0 37.0 35.0 37.0 7 36.611 37.0 37.0 37.0 35.0 37.0 8 36.565 37.0 37.0 37.0 35.0 37.0 9 38.46775 39.0 39.0 39.0 37.0 39.0 10-11 38.335125000000005 39.0 39.0 39.0 37.0 39.0 12-13 38.401250000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.98825 41.0 40.0 41.0 38.0 41.0 16-17 39.945499999999996 41.0 40.0 41.0 38.0 41.0 18-19 39.942750000000004 41.0 40.0 41.0 38.0 41.0 20-21 39.843125 41.0 40.0 41.0 38.0 41.0 22-23 39.778875 41.0 40.0 41.0 38.0 41.0 24-25 39.710375 41.0 40.0 41.0 37.5 41.0 26-27 39.67325 41.0 40.0 41.0 37.5 41.0 28-29 39.558375 41.0 40.0 41.0 37.0 41.0 30-31 39.144000000000005 41.0 39.0 41.0 36.0 41.0 32-33 39.432875 41.0 39.5 41.0 36.5 41.0 34-35 39.445125 41.0 40.0 41.0 37.0 41.0 36-37 39.3885 41.0 39.5 41.0 36.5 41.0 38-39 39.223 41.0 39.0 41.0 35.5 41.0 40-41 39.075 41.0 39.0 41.0 35.0 41.0 42-43 38.853875 40.5 38.5 41.0 35.0 41.0 44-45 38.67125 40.0 38.0 41.0 35.0 41.0 46-47 38.55575 40.0 38.0 41.0 35.0 41.0 48-49 38.466875 40.0 38.0 41.0 35.0 41.0 50-51 38.223 40.0 37.5 41.0 34.0 41.0 52-53 37.890125 40.0 37.0 41.0 33.5 41.0 54-55 37.840875 40.0 36.5 41.0 33.5 41.0 56-57 37.66825 40.0 36.0 41.0 33.5 41.0 58-59 37.325 39.5 35.5 41.0 33.0 41.0 60-61 37.159000000000006 39.0 35.0 41.0 33.0 41.0 62-63 36.9745 39.0 35.0 41.0 33.0 41.0 64-65 36.70025 38.5 35.0 40.5 32.5 41.0 66-67 36.37575 38.0 35.0 40.0 32.0 41.0 68-69 36.059875 37.0 35.0 40.0 31.5 41.0 70-71 35.4795 37.0 35.0 39.5 31.0 41.0 72-73 35.14275 36.0 34.5 39.0 30.5 41.0 74-75 34.63075 35.5 34.0 39.0 29.5 40.0 76-77 33.732875 35.0 33.5 37.0 28.5 39.0 78-79 34.184 35.0 34.0 37.0 30.0 39.0 80-81 33.981125000000006 35.0 34.0 37.0 30.0 39.0 82-83 33.726875 35.0 34.0 36.5 30.0 38.5 84-85 33.474000000000004 35.0 34.0 36.0 29.5 37.5 86-87 33.00475 35.0 34.0 36.0 29.0 37.0 88-89 32.8425 35.0 34.0 35.0 29.0 37.0 90-91 32.471375 35.0 33.5 35.0 28.0 36.0 92-93 32.179249999999996 35.0 33.0 35.0 27.0 36.0 94-95 31.997749999999996 35.0 33.0 35.0 27.0 36.0 96-97 31.798375 35.0 33.0 35.0 26.5 36.0 98-99 31.553375000000003 35.0 33.0 35.0 25.5 35.0 100 31.301 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 2.0 11 6.0 12 1.0 13 9.0 14 8.0 15 3.0 16 3.0 17 7.0 18 3.0 19 9.0 20 6.0 21 9.0 22 6.0 23 10.0 24 12.0 25 14.0 26 17.0 27 19.0 28 46.0 29 35.0 30 36.0 31 41.0 32 60.0 33 87.0 34 136.0 35 253.0 36 466.0 37 829.0 38 1336.0 39 522.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.243093922651934 19.412355600200904 18.35760924158714 35.986941235560025 2 21.8 24.875 30.65 22.675 3 23.425 24.474999999999998 28.525 23.575 4 24.85 27.175 24.775 23.200000000000003 5 23.75 31.6 24.075 20.575 6 22.95 32.324999999999996 24.775 19.950000000000003 7 21.099999999999998 22.975 35.4 20.525 8 21.625 25.25 30.025000000000002 23.1 9 21.349999999999998 24.15 30.7 23.799999999999997 10-11 22.3875 31.075000000000003 24.675 21.8625 12-13 22.325 26.7625 28.775000000000002 22.1375 14-15 22.375 28.262500000000003 27.3 22.0625 16-17 22.75 27.8625 27.3625 22.025 18-19 22.8375 27.425 26.900000000000002 22.8375 20-21 22.1375 28.4 27.425 22.037499999999998 22-23 22.6375 28.1 27.575 21.6875 24-25 22.375 27.6125 26.8125 23.200000000000003 26-27 22.2625 28.1625 27.425 22.15 28-29 22.625 26.474999999999998 28.0875 22.8125 30-31 22.6125 26.974999999999998 27.825 22.5875 32-33 21.975 28.1375 27.85 22.037499999999998 34-35 22.325 27.987499999999997 27.5875 22.1 36-37 22.5125 26.5375 28.525 22.425 38-39 21.475 28.275 28.6625 21.587500000000002 40-41 22.725 27.3 27.6125 22.3625 42-43 21.6875 28.9125 27.712500000000002 21.6875 44-45 22.037499999999998 28.125 28.1 21.7375 46-47 22.5 27.0125 28.037499999999998 22.45 48-49 23.2375 28.075 26.474999999999998 22.2125 50-51 21.748374187093546 28.264132066033014 27.48874437218609 22.498749374687343 52-53 22.73921200750469 27.267041901188243 27.66729205753596 22.326454033771107 54-55 22.650000000000002 27.950000000000003 27.05 22.35 56-57 21.837500000000002 26.450000000000003 28.9875 22.725 58-59 22.45 27.650000000000002 28.449999999999996 21.45 60-61 22.787499999999998 27.425 28.1125 21.675 62-63 21.95 27.537499999999998 27.787499999999998 22.725 64-65 21.9625 27.6875 28.212500000000002 22.1375 66-67 22.05 29.125 26.575 22.25 68-69 21.875 28.599999999999998 26.9625 22.5625 70-71 21.775 28.7 27.125 22.400000000000002 72-73 22.237499999999997 28.262500000000003 27.3875 22.112499999999997 74-75 22.4625 26.8375 28.1875 22.5125 76-77 22.425 26.787499999999998 27.6625 23.125 78-79 21.8125 27.55 27.55 23.0875 80-81 21.975 27.1 28.275 22.650000000000002 82-83 21.987499999999997 28.9 27.0625 22.05 84-85 22.525000000000002 27.487499999999997 28.287499999999998 21.7 86-87 22.037499999999998 28.8875 27.775 21.3 88-89 22.030507626906726 27.344336084021002 28.207051762940733 22.418104526131533 90-91 23.23080770192548 28.08202050512628 27.35683920980245 21.330332583145786 92-93 23.165395674459308 27.703462932866607 27.17839729966246 21.952744093011624 94-95 21.8625 28.1625 27.325 22.650000000000002 96-97 23.19039879984998 27.640955119389925 27.015876984623077 22.152769096137018 98-99 22.802850356294538 27.728466058257283 26.60332541567696 22.86535816977122 100 22.725 28.525 27.474999999999998 21.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.5 14 1.5 15 1.0 16 2.0 17 1.5 18 1.0 19 4.0 20 7.5 21 8.0 22 10.0 23 14.0 24 20.0 25 30.0 26 36.0 27 43.0 28 46.5 29 50.0 30 57.0 31 66.0 32 78.0 33 76.5 34 83.0 35 102.0 36 131.5 37 141.0 38 142.5 39 152.5 40 150.0 41 139.5 42 135.5 43 143.0 44 147.5 45 140.0 46 130.0 47 126.5 48 122.0 49 113.0 50 108.0 51 108.0 52 99.0 53 96.5 54 87.0 55 72.5 56 72.5 57 80.5 58 87.5 59 75.5 60 58.0 61 56.5 62 52.5 63 42.5 64 39.5 65 32.0 66 25.5 67 24.0 68 18.0 69 16.5 70 16.0 71 13.0 72 8.0 73 8.5 74 11.5 75 9.5 76 6.5 77 7.0 78 5.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.05 52-53 0.0625 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.025 90-91 0.025 92-93 0.0125 94-95 0.0 96-97 0.0125 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18905220476432 97.85000000000001 2 0.7095793208312215 1.4000000000000001 3 0.025342118601115054 0.075 4 0.0 0.0 5 0.025342118601115054 0.125 6 0.025342118601115054 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025342118601115054 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 16 0.4 TruSeq Adapter, Index 14 (97% over 44bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTA 6 0.15 TruSeq Adapter, Index 14 (97% over 44bp) TCTGCAGGATATCGCGGCCGCCATCTGCCCTACGTTTGAGGGTTATAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.16249999999999998 0.0 0.0 0.0 0.0 52-53 0.1875 0.0 0.0 0.0 0.0 54-55 0.2 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695871 spots for SRR3207878.sra Written 695871 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra Read 695861 spots for SRR3207878.sra Written 695861 spots for SRR3207878.sra SRR ids: ['SRR3207878.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1815oahf SRR3207878.sra spots: 13917230 blocks: [[1, 695861], [695862, 1391722], [1391723, 2087583], [2087584, 2783444], [2783445, 3479305], [3479306, 4175166], [4175167, 4871027], [4871028, 5566888], [5566889, 6262749], [6262750, 6958610], [6958611, 7654471], [7654472, 8350332], [8350333, 9046193], [9046194, 9742054], [9742055, 10437915], [10437916, 11133776], [11133777, 11829637], [11829638, 12525498], [12525499, 13221359], [13221360, 13917230]] SRR3207878 file size 3610973 SRR3207878 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207878 SRR3207878_1.fastq Input file: SRR3207878_1.fastq trimmed: SRR3207878-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:50:34 2025 >> started Tue Feb 11 11:50:41 2025 >> done (6.829s) 13917230 reads processed; of these: 3400 ( 0.02%) short reads filtered out after trimming by size control 74018 ( 0.53%) empty reads filtered out after trimming by size control 13839812 (99.44%) reads available; of these: 1563664 (11.30%) trimmed reads available after processing 12276148 (88.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 792 0.01% 19 916 0.01% 20 1246 0.01% 21 1504 0.01% 22 2048 0.01% 23 2760 0.02% 24 3484 0.03% 25 4386 0.03% 26 4382 0.03% 27 4463 0.03% 28 4429 0.03% 29 4964 0.04% 30 4717 0.03% 31 4877 0.04% 32 4645 0.03% 33 4743 0.03% 34 4974 0.04% 35 5135 0.04% 36 5539 0.04% 37 5804 0.04% 38 6021 0.04% 39 6592 0.05% 40 6539 0.05% 41 6533 0.05% 42 6963 0.05% 43 7292 0.05% 44 7494 0.05% 45 7600 0.05% 46 7828 0.06% 47 8211 0.06% 48 8688 0.06% 49 8809 0.06% 50 9617 0.07% 51 9369 0.07% 52 9942 0.07% 53 10359 0.07% 54 11397 0.08% 55 11588 0.08% 56 12040 0.09% 57 12589 0.09% 58 12949 0.09% 59 13041 0.09% 60 13063 0.09% 61 13405 0.10% 62 13439 0.10% 63 13727 0.10% 64 13747 0.10% 65 14075 0.10% 66 14120 0.10% 67 14614 0.11% 68 14917 0.11% 69 14062 0.10% 70 14027 0.10% 71 15111 0.11% 72 15286 0.11% 73 15486 0.11% 74 15252 0.11% 75 15354 0.11% 76 11538 0.08% 77 12794 0.09% 78 14813 0.11% 79 16318 0.12% 80 17718 0.13% 81 19347 0.14% 82 21019 0.15% 83 22559 0.16% 84 23913 0.17% 85 26558 0.19% 86 28076 0.20% 87 30292 0.22% 88 31994 0.23% 89 34502 0.25% 90 38353 0.28% 91 43074 0.31% 92 49407 0.36% 93 56207 0.41% 94 69590 0.50% 95 86000 0.62% 96 84543 0.61% 97 98147 0.71% 98 108491 0.78% 99 111457 0.81% 100 12276148 88.70% 13839812 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.44 fanout-score-rank=15 prefix-density=0.41 prefix-fanout=3.7 sequence=GCCTGTAATCCCAGC criterion=fanout-score sequence-density=0.26 sequence-density-rank=6 fanout-score=49.19 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=41.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Started job on | Feb 11 11:51:14 Started mapping on | Feb 11 11:51:14 Finished on | Feb 11 11:53:43 Mapping speed, Million of reads per hour | 334.38 Number of input reads | 13839812 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 2151748 Uniquely mapped reads % | 15.55% Average mapped length | 97.69 Number of splices: Total | 373180 Number of splices: Annotated (sjdb) | 360248 Number of splices: GT/AG | 365843 Number of splices: GC/AG | 4612 Number of splices: AT/AC | 511 Number of splices: Non-canonical | 2214 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.02% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 138582 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 1460016 % of reads mapped to too many loci | 10.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 72.78% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 11549482 11549482 11549482 N_multimapping 138582 138582 138582 N_noFeature 188136 1148092 1167859 N_ambiguous 32338 4279 4189 UnstrandedReadsAssigned:1931274 PositiveStrandReadsAssigned:999377 NegativeStrandReadsAssigned:979700 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207878 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207878-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,839,812 reads, 3,327,107 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR3207878.ke.tsv 34699 SRR3207878.se.tsv 87100 total ==> SRR3207878.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 39 6.90537 Potri.005G024800.1.v4.1 1035 936 29 10.5274 Potri.004G059700.1.v4.1 961 862 8 3.15341 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 21 2.50892 Potri.016G087400.1.v4.1 270 171 62 123.195 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.405949 Potri.012G127500.1.v4.1 977 878 244 94.4262 ==> SRR3207878.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 128 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 35 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207878 completed mapping pipeline successfully