Starting /dee2/code/volunteer_pipeline.sh SRR3207879 current disk space = 3052263784448 free memory = 1485500352 SRR3207879 SRAfilesize 7b607bb89bdbcf4850efdefa37f98558 SRR3207879.sra SRR3207879.sra file validated SRR3207879 is single end SRR3207879 is conventional basespace SRR3207879 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207879_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04175 34.0 33.0 34.0 31.0 34.0 2 33.227 34.0 34.0 34.0 31.0 34.0 3 33.3945 34.0 34.0 34.0 31.0 34.0 4 36.61175 37.0 37.0 37.0 35.0 37.0 5 36.5725 37.0 37.0 37.0 35.0 37.0 6 36.6095 37.0 37.0 37.0 35.0 37.0 7 36.6255 37.0 37.0 37.0 35.0 37.0 8 36.58375 37.0 37.0 37.0 35.0 37.0 9 38.52425 39.0 39.0 39.0 37.0 39.0 10-11 38.335499999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.414625 39.0 39.0 39.0 37.0 39.0 14-15 40.041 41.0 40.0 41.0 38.0 41.0 16-17 40.048375 41.0 40.0 41.0 38.0 41.0 18-19 40.06075 41.0 40.0 41.0 38.0 41.0 20-21 39.966125 41.0 40.0 41.0 38.0 41.0 22-23 39.925875 41.0 40.0 41.0 38.0 41.0 24-25 39.764125 41.0 40.0 41.0 37.5 41.0 26-27 39.84075 41.0 40.0 41.0 38.0 41.0 28-29 39.765625 41.0 40.0 41.0 38.0 41.0 30-31 39.371875 41.0 40.0 41.0 36.5 41.0 32-33 39.67575 41.0 40.0 41.0 37.5 41.0 34-35 39.69675 41.0 40.0 41.0 38.0 41.0 36-37 39.672 41.0 40.0 41.0 38.0 41.0 38-39 39.576625 41.0 40.0 41.0 37.0 41.0 40-41 39.510000000000005 41.0 40.0 41.0 37.0 41.0 42-43 39.3755 40.5 39.5 41.0 36.5 41.0 44-45 39.181875000000005 41.0 39.0 41.0 36.0 41.0 46-47 39.075874999999996 41.0 39.0 41.0 35.5 41.0 48-49 39.130250000000004 41.0 39.0 41.0 36.0 41.0 50-51 38.934625 40.5 39.0 41.0 35.0 41.0 52-53 38.695125000000004 40.0 39.0 41.0 35.0 41.0 54-55 38.748125 40.0 38.0 41.0 35.0 41.0 56-57 38.611000000000004 40.0 38.0 41.0 35.0 41.0 58-59 38.25475 40.0 37.5 41.0 34.5 41.0 60-61 38.077625 40.0 37.0 41.0 34.0 41.0 62-63 37.853750000000005 39.5 37.0 41.0 34.0 41.0 64-65 37.60275 39.0 36.0 41.0 34.0 41.0 66-67 37.215374999999995 39.0 36.0 40.0 34.0 41.0 68-69 36.787499999999994 37.5 35.0 40.0 33.0 41.0 70-71 36.14125 37.0 35.0 39.0 32.0 41.0 72-73 35.8825 36.5 35.0 39.0 32.5 40.5 74-75 35.185375 36.0 35.0 38.5 31.5 39.5 76-77 34.268 35.0 33.5 37.0 30.5 39.0 78-79 34.715125 35.0 34.5 37.0 31.5 39.0 80-81 34.3785 35.0 34.0 36.5 31.5 37.5 82-83 34.159125 35.0 34.0 36.0 31.5 37.0 84-85 33.86925 35.0 34.0 36.0 31.5 37.0 86-87 33.449375 35.0 34.0 35.0 31.0 36.0 88-89 33.3565 35.0 34.0 35.0 31.0 36.0 90-91 33.08775 35.0 34.0 35.0 30.0 36.0 92-93 32.91825 35.0 34.0 35.0 30.0 35.5 94-95 32.747 35.0 34.0 35.0 30.0 35.0 96-97 32.614125 35.0 34.0 35.0 29.5 35.0 98-99 32.494625 35.0 34.0 35.0 29.5 35.0 100 32.30275 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 2.0 10 0.0 11 2.0 12 2.0 13 4.0 14 4.0 15 5.0 16 1.0 17 4.0 18 5.0 19 4.0 20 2.0 21 4.0 22 3.0 23 8.0 24 12.0 25 5.0 26 12.0 27 23.0 28 24.0 29 22.0 30 29.0 31 38.0 32 52.0 33 67.0 34 96.0 35 154.0 36 329.0 37 917.0 38 1850.0 39 317.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.09223422970596 14.601658708218146 15.983915556672532 42.32219150540337 2 21.75 22.25 34.275 21.725 3 22.975 26.275 25.25 25.5 4 24.9 31.55 20.375 23.175 5 24.525 33.650000000000006 22.55 19.275000000000002 6 18.575 37.675 23.525 20.225 7 18.224999999999998 19.55 41.325 20.9 8 19.125 25.05 30.3 25.525 9 19.3 23.05 32.525 25.124999999999996 10-11 21.7875 33.9375 23.925 20.349999999999998 12-13 20.375 27.0125 29.7875 22.825 14-15 21.637500000000003 27.775 28.125 22.4625 16-17 22.7125 28.349999999999998 26.700000000000003 22.237499999999997 18-19 22.287499999999998 29.025000000000002 26.6 22.0875 20-21 21.95 28.6375 27.762500000000003 21.65 22-23 21.5375 29.65 27.0 21.8125 24-25 22.2625 27.987499999999997 28.050000000000004 21.7 26-27 21.65 28.075 27.5125 22.7625 28-29 21.912499999999998 28.712500000000002 26.9625 22.412499999999998 30-31 21.275 28.199999999999996 28.3875 22.1375 32-33 22.537499999999998 28.9125 26.950000000000003 21.6 34-35 22.575 28.475 27.712500000000002 21.2375 36-37 22.2 28.625 28.212500000000002 20.962500000000002 38-39 22.112499999999997 27.487499999999997 27.875 22.525000000000002 40-41 22.3875 28.262500000000003 27.037499999999998 22.3125 42-43 22.95 27.6125 28.125 21.3125 44-45 21.4375 28.5875 27.712500000000002 22.2625 46-47 22.0 28.449999999999996 27.3625 22.1875 48-49 21.8625 27.9125 27.762500000000003 22.4625 50-51 22.401500938086304 27.86741713570982 27.992495309568483 21.7385866166354 52-53 22.64764764764765 27.239739739739736 28.603603603603606 21.50900900900901 54-55 21.6875 29.1875 27.875 21.25 56-57 21.375 27.675 28.1 22.85 58-59 22.5625 27.375 28.4125 21.65 60-61 21.8625 27.6 27.825 22.7125 62-63 21.462500000000002 28.475 27.987499999999997 22.075 64-65 22.9375 27.6 27.150000000000002 22.3125 66-67 21.987499999999997 28.1875 27.5875 22.237499999999997 68-69 21.4125 28.3125 27.900000000000002 22.375 70-71 22.3875 27.625 27.675 22.3125 72-73 21.912499999999998 27.950000000000003 28.549999999999997 21.587500000000002 74-75 23.0 27.6875 28.000000000000004 21.3125 76-77 21.9 27.962500000000002 28.225 21.912499999999998 78-79 22.75 28.075 27.437499999999996 21.7375 80-81 21.475 28.762500000000003 27.537499999999998 22.225 82-83 21.775 28.249999999999996 27.3 22.675 84-85 21.7 28.4 28.0875 21.8125 86-87 22.175 27.762500000000003 27.675 22.3875 88-89 21.570588970864073 27.46029761160435 28.448168063023633 22.52094535450794 90-91 22.729547160370277 28.096072054040533 28.67150362772079 20.5028771578684 92-93 22.72102038264349 28.185569588595722 28.110541453044892 20.982868575715894 94-95 22.525000000000002 28.625 27.3375 21.512500000000003 96-97 22.3625 29.0875 26.6 21.95 98-99 22.675 27.175 28.1625 21.987499999999997 100 23.525 27.3 28.175 21.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 2.0 27 4.5 28 6.5 29 9.5 30 16.5 31 22.5 32 28.5 33 43.0 34 54.0 35 63.5 36 90.5 37 113.5 38 132.0 39 164.0 40 204.0 41 223.0 42 247.5 43 278.5 44 280.5 45 280.0 46 262.5 47 229.5 48 205.5 49 192.5 50 171.0 51 141.5 52 113.5 53 93.0 54 73.0 55 53.0 56 37.5 57 29.5 58 26.5 59 21.0 60 18.5 61 16.0 62 13.0 63 7.0 64 7.0 65 5.5 66 2.0 67 3.0 68 3.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 1.5 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0625 52-53 0.1 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.075 92-93 0.0375 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503119 spots for SRR3207879.sra Written 1503119 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra Read 1503105 spots for SRR3207879.sra Written 1503105 spots for SRR3207879.sra SRR ids: ['SRR3207879.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vqx5e7vc SRR3207879.sra spots: 30062114 blocks: [[1, 1503105], [1503106, 3006210], [3006211, 4509315], [4509316, 6012420], [6012421, 7515525], [7515526, 9018630], [9018631, 10521735], [10521736, 12024840], [12024841, 13527945], [13527946, 15031050], [15031051, 16534155], [16534156, 18037260], [18037261, 19540365], [19540366, 21043470], [21043471, 22546575], [22546576, 24049680], [24049681, 25552785], [25552786, 27055890], [27055891, 28558995], [28558996, 30062114]] SRR3207879 file size 7812512 SRR3207879 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207879 SRR3207879_1.fastq Input file: SRR3207879_1.fastq trimmed: SRR3207879-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:14:06 2025 >> started Tue Feb 11 11:14:20 2025 >> done (13.385s) 30062114 reads processed; of these: 5901 ( 0.02%) short reads filtered out after trimming by size control 43916 ( 0.15%) empty reads filtered out after trimming by size control 30012297 (99.83%) reads available; of these: 2504827 ( 8.35%) trimmed reads available after processing 27507470 (91.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1018 0.00% 19 1196 0.00% 20 1382 0.00% 21 1920 0.01% 22 2534 0.01% 23 3470 0.01% 24 4269 0.01% 25 5780 0.02% 26 5961 0.02% 27 5636 0.02% 28 6000 0.02% 29 6060 0.02% 30 5857 0.02% 31 5841 0.02% 32 5770 0.02% 33 5993 0.02% 34 6204 0.02% 35 6473 0.02% 36 7022 0.02% 37 7318 0.02% 38 7857 0.03% 39 8135 0.03% 40 8756 0.03% 41 8873 0.03% 42 9348 0.03% 43 9735 0.03% 44 10431 0.03% 45 10862 0.04% 46 11335 0.04% 47 12036 0.04% 48 12673 0.04% 49 12963 0.04% 50 13942 0.05% 51 13851 0.05% 52 14712 0.05% 53 15286 0.05% 54 16578 0.06% 55 17380 0.06% 56 18323 0.06% 57 18878 0.06% 58 19366 0.06% 59 19484 0.06% 60 19665 0.07% 61 19875 0.07% 62 20282 0.07% 63 20343 0.07% 64 20334 0.07% 65 20878 0.07% 66 20811 0.07% 67 21454 0.07% 68 22532 0.08% 69 22433 0.07% 70 22264 0.07% 71 23112 0.08% 72 23697 0.08% 73 24422 0.08% 74 24530 0.08% 75 24137 0.08% 76 17986 0.06% 77 20604 0.07% 78 23347 0.08% 79 25962 0.09% 80 27672 0.09% 81 30302 0.10% 82 33107 0.11% 83 35908 0.12% 84 37759 0.13% 85 42239 0.14% 86 44601 0.15% 87 47490 0.16% 88 51530 0.17% 89 54472 0.18% 90 60768 0.20% 91 69832 0.23% 92 80695 0.27% 93 92167 0.31% 94 119528 0.40% 95 149063 0.50% 96 145930 0.49% 97 169199 0.56% 98 189807 0.63% 99 197582 0.66% 100 27507470 91.65% 30012297 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=4.51 fanout-score-rank=13 prefix-density=0.13 prefix-fanout=3.6 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=107.08 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=13.1 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGG Started job on | Feb 11 11:15:09 Started mapping on | Feb 11 11:15:09 Finished on | Feb 11 11:15:41 Mapping speed, Million of reads per hour | 3376.38 Number of input reads | 30012297 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 28017286 Uniquely mapped reads % | 93.35% Average mapped length | 98.29 Number of splices: Total | 7485263 Number of splices: Annotated (sjdb) | 7321860 Number of splices: GT/AG | 7363562 Number of splices: GC/AG | 99542 Number of splices: AT/AC | 7879 Number of splices: Non-canonical | 14280 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 997573 % of reads mapped to multiple loci | 3.32% Number of reads mapped to too many loci | 590132 % of reads mapped to too many loci | 1.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 997438 997438 997438 N_multimapping 997573 997573 997573 N_noFeature 1220675 14435529 14577480 N_ambiguous 325439 50413 50671 UnstrandedReadsAssigned:26471172 PositiveStrandReadsAssigned:13531344 NegativeStrandReadsAssigned:13389135 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207879 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207879-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,012,297 reads, 27,752,706 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,303 rounds 52401 SRR3207879.ke.tsv 34699 SRR3207879.se.tsv 87100 total ==> SRR3207879.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1578 35.7201 Potri.005G024800.1.v4.1 1035 936 4279.16 198.593 Potri.004G059700.1.v4.1 961 862 38 1.91495 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 643.031 9.82161 Potri.016G087400.1.v4.1 270 171 1136 288.578 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 423 10.9765 Potri.012G127500.1.v4.1 977 878 4837 239.311 ==> SRR3207879.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1850 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 460 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 57 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 50 SRR3207879 completed mapping pipeline successfully