Starting /dee2/code/volunteer_pipeline.sh SRR3207880 current disk space = 3051217707008 free memory = 1580064120 SRR3207880 SRAfilesize af4d9e20fb66c52b3114ebd787403bac SRR3207880.sra SRR3207880.sra file validated SRR3207880 is single end SRR3207880 is conventional basespace SRR3207880 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207880_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8865 34.0 33.0 34.0 31.0 34.0 2 33.15875 34.0 34.0 34.0 31.0 34.0 3 33.294 34.0 34.0 34.0 31.0 34.0 4 36.5815 37.0 37.0 37.0 35.0 37.0 5 36.52425 37.0 37.0 37.0 35.0 37.0 6 36.52275 37.0 37.0 37.0 35.0 37.0 7 36.526 37.0 37.0 37.0 35.0 37.0 8 36.48475 37.0 37.0 37.0 35.0 37.0 9 38.34175 39.0 39.0 39.0 37.0 39.0 10-11 38.3335 39.0 39.0 39.0 37.0 39.0 12-13 38.277125 39.0 39.0 39.0 37.0 39.0 14-15 39.848375000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.813874999999996 41.0 40.0 41.0 38.0 41.0 18-19 39.66525 41.0 40.0 41.0 37.0 41.0 20-21 39.5715 41.0 40.0 41.0 37.0 41.0 22-23 39.4235 41.0 39.5 41.0 36.5 41.0 24-25 39.454125000000005 41.0 39.5 41.0 36.5 41.0 26-27 39.2845 41.0 39.0 41.0 36.0 41.0 28-29 39.2495 41.0 39.0 41.0 36.0 41.0 30-31 38.908500000000004 41.0 39.0 41.0 35.5 41.0 32-33 39.173375 41.0 39.0 41.0 36.0 41.0 34-35 39.2095 41.0 39.0 41.0 36.0 41.0 36-37 39.188375 41.0 39.0 41.0 36.0 41.0 38-39 38.9595 40.5 39.0 41.0 35.5 41.0 40-41 38.873625000000004 40.0 39.0 41.0 35.0 41.0 42-43 38.967749999999995 40.0 39.0 41.0 35.0 41.0 44-45 38.887125 40.0 39.0 41.0 35.0 41.0 46-47 38.68625 40.5 38.5 41.0 34.5 41.0 48-49 38.486000000000004 40.0 38.0 41.0 34.5 41.0 50-51 38.300749999999994 40.0 38.0 41.0 34.0 41.0 52-53 38.47225 40.0 38.0 41.0 34.5 41.0 54-55 38.333625 40.0 38.0 41.0 34.0 41.0 56-57 38.186499999999995 40.0 38.0 41.0 34.0 41.0 58-59 37.817499999999995 40.0 37.0 41.0 33.5 41.0 60-61 37.369125 39.5 36.0 41.0 32.5 41.0 62-63 37.149625 39.0 36.0 41.0 32.0 41.0 64-65 36.923249999999996 39.0 35.5 40.5 32.0 41.0 66-67 36.634125 38.5 35.0 40.0 32.0 41.0 68-69 36.168000000000006 37.5 35.0 40.0 31.0 41.0 70-71 35.392375 37.0 35.0 39.0 30.0 41.0 72-73 35.0475 36.0 35.0 39.0 30.0 40.0 74-75 34.6345 36.0 34.0 38.5 30.0 39.5 76-77 33.53775 35.0 33.0 37.0 28.5 39.0 78-79 33.676 35.0 34.0 37.0 29.0 39.0 80-81 33.782125 35.0 34.0 36.5 30.0 37.5 82-83 33.53225 35.0 34.0 36.0 30.0 37.0 84-85 33.205875000000006 35.0 34.0 36.0 29.5 37.0 86-87 32.844125 35.0 34.0 35.0 29.0 36.0 88-89 32.47 35.0 33.0 35.0 28.0 36.0 90-91 32.43662500000001 35.0 33.5 35.0 29.0 36.0 92-93 32.148250000000004 35.0 33.0 35.0 27.0 35.5 94-95 32.1385 35.0 33.0 35.0 27.5 35.0 96-97 31.930999999999997 35.0 33.0 35.0 27.0 35.0 98-99 31.740000000000002 35.0 33.0 35.0 27.0 35.0 100 31.5475 35.0 33.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 5.0 10 3.0 11 2.0 12 6.0 13 4.0 14 4.0 15 2.0 16 8.0 17 6.0 18 10.0 19 9.0 20 10.0 21 7.0 22 11.0 23 13.0 24 13.0 25 13.0 26 23.0 27 22.0 28 27.0 29 25.0 30 50.0 31 49.0 32 74.0 33 96.0 34 118.0 35 206.0 36 335.0 37 910.0 38 1656.0 39 283.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.5794110244148 15.731185502139441 13.717593757865593 43.971809715580164 2 19.5 21.725 36.425000000000004 22.35 3 21.85 24.75 26.6 26.8 4 24.075 30.625000000000004 22.3 23.0 5 26.325 33.15 23.125 17.4 6 20.125 37.075 23.275000000000002 19.525000000000002 7 17.175 20.674999999999997 41.5 20.65 8 19.375 24.975 30.925000000000004 24.725 9 19.900000000000002 24.05 31.4 24.65 10-11 23.3125 33.775 22.825 20.0875 12-13 20.974999999999998 27.1625 29.025000000000002 22.8375 14-15 21.3625 28.050000000000004 27.8125 22.775000000000002 16-17 21.625 28.925 27.075 22.375 18-19 22.2 29.1125 26.5625 22.125 20-21 22.05 28.962500000000002 27.05 21.9375 22-23 21.6125 29.612500000000004 26.937499999999996 21.837500000000002 24-25 21.2 28.999999999999996 27.375 22.425 26-27 21.575 29.4875 27.3 21.637500000000003 28-29 22.175 28.1125 27.275 22.4375 30-31 21.1625 28.7375 27.8125 22.287499999999998 32-33 21.587500000000002 28.425 27.3125 22.675 34-35 22.037499999999998 27.6875 27.987499999999997 22.287499999999998 36-37 20.9125 28.8625 27.712500000000002 22.5125 38-39 21.7375 27.787499999999998 28.175 22.3 40-41 22.5 27.825 27.1125 22.5625 42-43 21.6 27.650000000000002 28.299999999999997 22.45 44-45 21.85 28.6125 28.1 21.4375 46-47 22.400000000000002 28.1125 26.575 22.912499999999998 48-49 21.2875 28.875 27.650000000000002 22.1875 50-51 22.355588897224308 27.169292323080768 28.14453613403351 22.330582645661416 52-53 21.842960740185045 27.59439859964991 28.394598649662417 22.168042010502624 54-55 22.15 27.212500000000002 28.025 22.6125 56-57 21.762500000000003 27.675 28.299999999999997 22.2625 58-59 21.637500000000003 28.3625 27.962500000000002 22.037499999999998 60-61 21.625 28.012500000000003 28.249999999999996 22.112499999999997 62-63 20.837500000000002 28.749999999999996 28.012500000000003 22.400000000000002 64-65 21.075 28.4 27.9375 22.5875 66-67 22.3125 28.1 27.6 21.987499999999997 68-69 22.5 27.8125 28.299999999999997 21.3875 70-71 21.575 28.1625 27.6875 22.575 72-73 21.987499999999997 28.3125 27.712500000000002 21.987499999999997 74-75 22.0 27.950000000000003 27.437499999999996 22.6125 76-77 21.45 27.712500000000002 28.499999999999996 22.3375 78-79 22.0625 27.750000000000004 28.025 22.162499999999998 80-81 21.55 28.65 27.950000000000003 21.85 82-83 21.1625 28.199999999999996 28.5625 22.075 84-85 22.6 27.212500000000002 27.85 22.3375 86-87 22.55 28.1875 27.6375 21.625 88-89 22.20555138784696 27.906976744186046 28.419604901225306 21.467866966741685 90-91 22.283356258596974 28.260597724146553 27.597849193447544 21.858196823808928 92-93 22.06801700425106 27.819454863715933 28.469617404351087 21.642910727681922 94-95 21.775 28.3125 27.437499999999996 22.475 96-97 22.3375 27.950000000000003 27.787499999999998 21.925 98-99 22.325 28.3625 27.3375 21.975 100 21.85 28.449999999999996 27.900000000000002 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 3.0 26 3.5 27 3.5 28 5.0 29 13.0 30 16.5 31 21.0 32 31.5 33 41.0 34 58.0 35 69.5 36 86.0 37 114.0 38 147.0 39 176.5 40 205.0 41 234.0 42 256.0 43 268.5 44 264.5 45 252.0 46 248.5 47 235.5 48 224.5 49 206.0 50 165.0 51 143.0 52 112.5 53 86.0 54 70.5 55 45.5 56 34.5 57 28.0 58 20.0 59 20.5 60 20.0 61 12.5 62 7.0 63 5.5 64 4.5 65 3.5 66 4.5 67 7.0 68 4.5 69 2.5 70 1.5 71 1.5 72 1.5 73 1.5 74 2.5 75 2.5 76 1.0 77 1.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.025 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.025 90-91 0.0375 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.2509410288582183 0.5 3 0.02509410288582183 0.075 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122638 spots for SRR3207880.sra Written 1122638 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra Read 1122634 spots for SRR3207880.sra Written 1122634 spots for SRR3207880.sra SRR ids: ['SRR3207880.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_juh2qyn8 SRR3207880.sra spots: 22452684 blocks: [[1, 1122634], [1122635, 2245268], [2245269, 3367902], [3367903, 4490536], [4490537, 5613170], [5613171, 6735804], [6735805, 7858438], [7858439, 8981072], [8981073, 10103706], [10103707, 11226340], [11226341, 12348974], [12348975, 13471608], [13471609, 14594242], [14594243, 15716876], [15716877, 16839510], [16839511, 17962144], [17962145, 19084778], [19084779, 20207412], [20207413, 21330046], [21330047, 22452684]] SRR3207880 file size 5832276 SRR3207880 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207880 SRR3207880_1.fastq Input file: SRR3207880_1.fastq trimmed: SRR3207880-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:00:09 2025 >> started Tue Feb 11 12:00:20 2025 >> done (11.206s) 22452684 reads processed; of these: 2796 ( 0.01%) short reads filtered out after trimming by size control 11268 ( 0.05%) empty reads filtered out after trimming by size control 22438620 (99.94%) reads available; of these: 1864644 ( 8.31%) trimmed reads available after processing 20573976 (91.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 568 0.00% 19 741 0.00% 20 963 0.00% 21 1203 0.01% 22 1597 0.01% 23 2201 0.01% 24 2829 0.01% 25 3886 0.02% 26 3769 0.02% 27 3735 0.02% 28 3898 0.02% 29 3843 0.02% 30 3877 0.02% 31 3931 0.02% 32 3901 0.02% 33 4125 0.02% 34 4508 0.02% 35 4652 0.02% 36 5059 0.02% 37 5428 0.02% 38 5830 0.03% 39 5886 0.03% 40 6413 0.03% 41 6586 0.03% 42 7176 0.03% 43 7422 0.03% 44 7919 0.04% 45 8156 0.04% 46 8641 0.04% 47 9115 0.04% 48 9666 0.04% 49 10069 0.04% 50 10838 0.05% 51 11058 0.05% 52 11324 0.05% 53 12071 0.05% 54 13222 0.06% 55 13414 0.06% 56 14336 0.06% 57 14487 0.06% 58 14941 0.07% 59 14724 0.07% 60 15344 0.07% 61 15212 0.07% 62 15700 0.07% 63 15390 0.07% 64 15728 0.07% 65 16073 0.07% 66 16342 0.07% 67 16363 0.07% 68 17052 0.08% 69 17118 0.08% 70 17401 0.08% 71 18267 0.08% 72 18562 0.08% 73 18718 0.08% 74 19171 0.09% 75 19228 0.09% 76 13458 0.06% 77 15663 0.07% 78 17640 0.08% 79 19611 0.09% 80 21566 0.10% 81 22636 0.10% 82 24535 0.11% 83 27736 0.12% 84 27911 0.12% 85 30410 0.14% 86 32583 0.15% 87 36499 0.16% 88 38448 0.17% 89 41875 0.19% 90 46864 0.21% 91 51237 0.23% 92 58975 0.26% 93 68056 0.30% 94 78820 0.35% 95 91778 0.41% 96 110923 0.49% 97 129620 0.58% 98 147686 0.66% 99 150437 0.67% 100 20573976 91.69% 22438620 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=9.47 fanout-score-rank=9 prefix-density=0.07 prefix-fanout=9.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=237.27 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=25.7 sequence=AAGAAGAAGAAA Started job on | Feb 11 12:00:39 Started mapping on | Feb 11 12:00:39 Finished on | Feb 11 12:01:04 Mapping speed, Million of reads per hour | 3231.16 Number of input reads | 22438620 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20682899 Uniquely mapped reads % | 92.18% Average mapped length | 98.30 Number of splices: Total | 5634513 Number of splices: Annotated (sjdb) | 5517545 Number of splices: GT/AG | 5542771 Number of splices: GC/AG | 75227 Number of splices: AT/AC | 6430 Number of splices: Non-canonical | 10085 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 552789 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 805271 % of reads mapped to too many loci | 3.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.76% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1202932 1202932 1202932 N_multimapping 552789 552789 552789 N_noFeature 889454 10631912 10760584 N_ambiguous 256405 38407 38595 UnstrandedReadsAssigned:19537040 PositiveStrandReadsAssigned:10012580 NegativeStrandReadsAssigned:9883720 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207880 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207880-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,438,620 reads, 20,688,871 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52401 SRR3207880.ke.tsv 34699 SRR3207880.se.tsv 87100 total ==> SRR3207880.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 887 29.1939 Potri.005G024800.1.v4.1 1035 936 479 32.3224 Potri.004G059700.1.v4.1 961 862 95 6.96082 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 429.137 9.53039 Potri.016G087400.1.v4.1 270 171 883 326.143 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 97.6362 3.68383 Potri.012G127500.1.v4.1 977 878 4169 299.903 ==> SRR3207880.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2365 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 352 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 87 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207880 completed mapping pipeline successfully