Starting /dee2/code/volunteer_pipeline.sh SRR3207881 current disk space = 3051215814656 free memory = 1579249428 SRR3207881 SRAfilesize 47662e2f373f7256e01f088f7a9f5d62 SRR3207881.sra SRR3207881.sra file validated SRR3207881 is single end SRR3207881 is conventional basespace SRR3207881 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207881_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7765 34.0 33.0 34.0 31.0 34.0 2 33.09075 34.0 34.0 34.0 31.0 34.0 3 33.2885 34.0 34.0 34.0 31.0 34.0 4 36.58275 37.0 37.0 37.0 35.0 37.0 5 36.53825 37.0 37.0 37.0 35.0 37.0 6 36.50825 37.0 37.0 37.0 35.0 37.0 7 36.47325 37.0 37.0 37.0 35.0 37.0 8 36.46575 37.0 37.0 37.0 35.0 37.0 9 38.35725 39.0 39.0 39.0 37.0 39.0 10-11 38.318375 39.0 39.0 39.0 37.0 39.0 12-13 38.28525 39.0 39.0 39.0 37.0 39.0 14-15 39.82225 41.0 40.0 41.0 38.0 41.0 16-17 39.76825 41.0 40.0 41.0 37.5 41.0 18-19 39.650999999999996 41.0 40.0 41.0 37.0 41.0 20-21 39.535375 41.0 40.0 41.0 37.0 41.0 22-23 39.38475 41.0 40.0 41.0 36.5 41.0 24-25 39.40075 41.0 39.0 41.0 36.5 41.0 26-27 39.159 41.0 39.0 41.0 36.0 41.0 28-29 39.156625 41.0 39.0 41.0 36.0 41.0 30-31 38.971500000000006 40.5 39.0 41.0 35.5 41.0 32-33 39.132374999999996 41.0 39.0 41.0 35.5 41.0 34-35 39.188875 41.0 39.0 41.0 36.0 41.0 36-37 39.216 41.0 39.0 41.0 36.0 41.0 38-39 38.778625000000005 40.5 38.5 41.0 34.5 41.0 40-41 38.734625 40.0 38.5 41.0 35.0 41.0 42-43 38.891625000000005 40.0 39.0 41.0 35.0 41.0 44-45 38.85925 40.0 39.0 41.0 35.0 41.0 46-47 38.580749999999995 40.0 38.5 41.0 34.5 41.0 48-49 38.41975 40.0 38.0 41.0 34.0 41.0 50-51 38.17675 40.0 38.0 41.0 33.5 41.0 52-53 38.3405 40.0 38.0 41.0 34.0 41.0 54-55 38.215375 40.0 38.0 41.0 34.0 41.0 56-57 38.11775 40.0 38.0 41.0 34.0 41.0 58-59 37.77075 40.0 37.0 41.0 33.5 41.0 60-61 37.22775 39.0 36.0 41.0 32.0 41.0 62-63 37.113125 39.0 36.0 41.0 32.0 41.0 64-65 36.747 39.0 35.0 40.5 32.0 41.0 66-67 36.537875 38.0 35.0 40.0 32.0 41.0 68-69 36.151250000000005 37.5 35.0 40.0 31.0 41.0 70-71 35.378125 37.0 35.0 39.0 30.0 41.0 72-73 34.8315 36.0 34.0 39.0 29.5 40.0 74-75 34.475 36.0 34.0 38.0 29.5 39.5 76-77 33.498000000000005 35.0 33.0 36.5 28.5 39.0 78-79 33.573125000000005 35.0 33.5 37.0 29.0 39.0 80-81 33.6605 35.0 34.0 36.0 29.5 37.5 82-83 33.4185 35.0 34.0 36.0 30.0 37.0 84-85 33.112375 35.0 34.0 36.0 29.0 37.0 86-87 32.6265 35.0 34.0 35.0 28.5 36.0 88-89 32.332875 35.0 33.0 35.0 27.5 36.0 90-91 32.369625 35.0 33.5 35.0 29.0 36.0 92-93 32.12125 35.0 33.0 35.0 27.0 35.0 94-95 31.972375 35.0 33.0 35.0 28.0 35.0 96-97 31.809 35.0 33.0 35.0 27.0 35.0 98-99 31.54175 35.0 33.0 35.0 26.0 35.0 100 31.29875 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 4.0 11 0.0 12 8.0 13 2.0 14 7.0 15 7.0 16 8.0 17 9.0 18 10.0 19 10.0 20 7.0 21 14.0 22 9.0 23 10.0 24 15.0 25 18.0 26 13.0 27 21.0 28 28.0 29 39.0 30 39.0 31 56.0 32 62.0 33 94.0 34 117.0 35 245.0 36 348.0 37 959.0 38 1558.0 39 281.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.625568468923703 14.527539161192522 15.411824153612935 41.43506821627084 2 22.075 21.5 33.975 22.45 3 23.05 25.775 24.4 26.775 4 23.825 32.175 19.650000000000002 24.349999999999998 5 25.55 34.075 22.125 18.25 6 19.425 36.625 23.325000000000003 20.625 7 17.125 19.55 43.025000000000006 20.3 8 20.75 24.099999999999998 28.799999999999997 26.35 9 19.85 25.35 30.75 24.05 10-11 22.7 33.3375 22.5125 21.45 12-13 20.8 26.825 29.675 22.7 14-15 22.6125 26.887499999999996 28.3875 22.112499999999997 16-17 21.475 28.050000000000004 27.962500000000002 22.5125 18-19 21.725 29.037499999999998 27.075 22.162499999999998 20-21 21.712500000000002 28.725 27.075 22.4875 22-23 22.3875 28.475 26.724999999999998 22.412499999999998 24-25 21.1875 29.612500000000004 27.487499999999997 21.712500000000002 26-27 22.725 28.3875 26.7625 22.125 28-29 20.925 27.575 28.6375 22.8625 30-31 22.8875 27.450000000000003 27.85 21.8125 32-33 22.225 27.725 27.85 22.2 34-35 22.175 27.8125 27.675 22.3375 36-37 21.912499999999998 28.625 27.1375 22.325 38-39 21.9375 28.037499999999998 27.1375 22.8875 40-41 22.2 27.737499999999997 28.287499999999998 21.775 42-43 21.912499999999998 27.700000000000003 28.275 22.112499999999997 44-45 21.9 28.037499999999998 28.1625 21.9 46-47 21.8625 28.325 27.525 22.287499999999998 48-49 22.112499999999997 27.3875 27.762500000000003 22.7375 50-51 22.39048811013767 27.847309136420527 26.9837296620776 22.778473091364205 52-53 22.024777875109496 27.330747090476788 28.16919033913152 22.47528469528219 54-55 22.375 28.199999999999996 27.675 21.75 56-57 22.400000000000002 28.0875 27.35 22.162499999999998 58-59 21.1625 29.1375 27.775 21.925 60-61 21.987499999999997 28.499999999999996 27.625 21.8875 62-63 21.6 27.650000000000002 28.475 22.275 64-65 21.5 28.4375 27.6375 22.425 66-67 21.65 28.325 27.6375 22.3875 68-69 22.35 27.650000000000002 27.750000000000004 22.25 70-71 22.237499999999997 27.625 27.5875 22.55 72-73 21.75 28.5875 27.125 22.537499999999998 74-75 22.3 28.225 27.525 21.95 76-77 21.475 28.787499999999998 27.437499999999996 22.3 78-79 21.875 27.8625 28.037499999999998 22.225 80-81 22.090261282660332 27.803475434429302 28.366045755719465 21.7402175271909 82-83 22.0 28.000000000000004 27.987499999999997 22.0125 84-85 22.095785919719894 27.472802300862824 28.2856071026635 22.145804676753784 86-87 22.233337501563085 28.123046142303366 28.010503938977116 21.633112417156433 88-89 22.225003128519585 28.044049555750217 28.381929670879742 21.349017644850456 90-91 22.19997497184332 27.74371167563509 28.356901514203482 21.69941183831811 92-93 22.06508135168961 27.284105131414265 28.197747183979978 22.453066332916144 94-95 21.64832416208104 27.388694347173587 28.72686343171586 22.236118059029515 96-97 22.061030515257627 27.763881940970485 28.026513256628316 22.14857428714357 98-99 22.486243121560783 27.901450725362682 28.301650825412704 21.310655327663834 100 22.7 26.650000000000002 28.725 21.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 1.5 28 6.5 29 10.5 30 9.0 31 16.5 32 30.5 33 42.5 34 56.0 35 71.0 36 93.5 37 112.0 38 135.5 39 169.0 40 197.5 41 218.5 42 233.0 43 249.0 44 267.5 45 281.0 46 275.0 47 241.5 48 224.0 49 210.5 50 178.5 51 144.0 52 109.0 53 82.5 54 66.5 55 60.0 56 47.5 57 34.0 58 23.5 59 20.5 60 18.0 61 12.5 62 9.5 63 7.5 64 9.5 65 7.0 66 3.5 67 3.0 68 2.0 69 2.0 70 1.0 71 1.5 72 1.5 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.125 52-53 0.11249999999999999 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0375 86-87 0.0375 88-89 0.11249999999999999 90-91 0.11249999999999999 92-93 0.125 94-95 0.05 96-97 0.05 98-99 0.05 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493037 spots for SRR3207881.sra Written 1493037 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra Read 1493033 spots for SRR3207881.sra Written 1493033 spots for SRR3207881.sra SRR ids: ['SRR3207881.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jna__3vy SRR3207881.sra spots: 29860664 blocks: [[1, 1493033], [1493034, 2986066], [2986067, 4479099], [4479100, 5972132], [5972133, 7465165], [7465166, 8958198], [8958199, 10451231], [10451232, 11944264], [11944265, 13437297], [13437298, 14930330], [14930331, 16423363], [16423364, 17916396], [17916397, 19409429], [19409430, 20902462], [20902463, 22395495], [22395496, 23888528], [23888529, 25381561], [25381562, 26874594], [26874595, 28367627], [28367628, 29860664]] SRR3207881 file size 7760132 SRR3207881 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207881 SRR3207881_1.fastq Input file: SRR3207881_1.fastq trimmed: SRR3207881-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:04:23 2025 >> started Tue Feb 11 12:04:43 2025 >> done (20.522s) 29860664 reads processed; of these: 4134 ( 0.01%) short reads filtered out after trimming by size control 46214 ( 0.15%) empty reads filtered out after trimming by size control 29810316 (99.83%) reads available; of these: 2588513 ( 8.68%) trimmed reads available after processing 27221803 (91.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 742 0.00% 19 873 0.00% 20 1140 0.00% 21 1443 0.00% 22 2040 0.01% 23 2817 0.01% 24 3566 0.01% 25 5183 0.02% 26 4999 0.02% 27 4853 0.02% 28 4941 0.02% 29 4887 0.02% 30 4928 0.02% 31 4972 0.02% 32 5268 0.02% 33 5402 0.02% 34 5780 0.02% 35 6079 0.02% 36 6610 0.02% 37 7086 0.02% 38 7438 0.02% 39 7966 0.03% 40 8386 0.03% 41 8683 0.03% 42 9440 0.03% 43 9917 0.03% 44 10437 0.04% 45 10934 0.04% 46 11512 0.04% 47 12080 0.04% 48 12976 0.04% 49 13770 0.05% 50 14504 0.05% 51 14761 0.05% 52 15217 0.05% 53 16059 0.05% 54 17766 0.06% 55 18357 0.06% 56 19653 0.07% 57 19888 0.07% 58 20663 0.07% 59 20573 0.07% 60 21168 0.07% 61 20939 0.07% 62 21834 0.07% 63 21452 0.07% 64 21915 0.07% 65 21916 0.07% 66 22631 0.08% 67 23009 0.08% 68 24033 0.08% 69 24676 0.08% 70 24329 0.08% 71 25419 0.09% 72 25730 0.09% 73 26670 0.09% 74 26871 0.09% 75 26450 0.09% 76 18832 0.06% 77 21782 0.07% 78 24608 0.08% 79 27285 0.09% 80 29786 0.10% 81 31737 0.11% 82 34184 0.11% 83 38850 0.13% 84 39319 0.13% 85 42299 0.14% 86 45481 0.15% 87 51577 0.17% 88 54145 0.18% 89 58660 0.20% 90 65783 0.22% 91 72058 0.24% 92 82327 0.28% 93 95449 0.32% 94 111070 0.37% 95 128283 0.43% 96 154846 0.52% 97 180157 0.60% 98 206698 0.69% 99 209666 0.70% 100 27221803 91.32% 29810316 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=8.69 fanout-score-rank=15 prefix-density=0.05 prefix-fanout=8.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=288.05 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=27.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 12:05:07 Started mapping on | Feb 11 12:05:07 Finished on | Feb 11 12:05:38 Mapping speed, Million of reads per hour | 3461.84 Number of input reads | 29810316 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 28068037 Uniquely mapped reads % | 94.16% Average mapped length | 98.24 Number of splices: Total | 7976450 Number of splices: Annotated (sjdb) | 7814140 Number of splices: GT/AG | 7849194 Number of splices: GC/AG | 104558 Number of splices: AT/AC | 9238 Number of splices: Non-canonical | 13460 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 761427 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 586323 % of reads mapped to too many loci | 1.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 980852 980852 980852 N_multimapping 761427 761427 761427 N_noFeature 1219897 14511567 14578381 N_ambiguous 301129 51391 52231 UnstrandedReadsAssigned:26547011 PositiveStrandReadsAssigned:13505079 NegativeStrandReadsAssigned:13437425 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207881 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207881-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,810,316 reads, 27,646,686 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,279 rounds 52401 SRR3207881.ke.tsv 34699 SRR3207881.se.tsv 87100 total ==> SRR3207881.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1539 40.7648 Potri.005G024800.1.v4.1 1035 936 512 27.8045 Potri.004G059700.1.v4.1 961 862 51 3.00735 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 692.247 12.3724 Potri.016G087400.1.v4.1 270 171 1277 379.591 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 83 2.52025 Potri.012G127500.1.v4.1 977 878 3683 213.22 ==> SRR3207881.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3004 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 454 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 59 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207881 completed mapping pipeline successfully