Starting /dee2/code/volunteer_pipeline.sh SRR3207882 current disk space = 3050975637504 free memory = 1579104528 SRR3207882 SRAfilesize 3d23602f5b3a458ded8d1abde6f0c2a5 SRR3207882.sra SRR3207882.sra file validated SRR3207882 is single end SRR3207882 is conventional basespace SRR3207882 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207882_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7325 34.0 33.0 34.0 31.0 34.0 2 33.06025 34.0 34.0 34.0 31.0 34.0 3 33.2495 34.0 34.0 34.0 31.0 34.0 4 36.54575 37.0 37.0 37.0 35.0 37.0 5 36.5265 37.0 37.0 37.0 35.0 37.0 6 36.5455 37.0 37.0 37.0 35.0 37.0 7 36.51375 37.0 37.0 37.0 35.0 37.0 8 36.52875 37.0 37.0 37.0 35.0 37.0 9 38.34125 39.0 39.0 39.0 37.0 39.0 10-11 38.354124999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.304375 39.0 39.0 39.0 37.0 39.0 14-15 39.868625 41.0 40.0 41.0 38.0 41.0 16-17 39.78375 41.0 40.0 41.0 37.0 41.0 18-19 39.660250000000005 41.0 40.0 41.0 37.0 41.0 20-21 39.576375 41.0 40.0 41.0 37.0 41.0 22-23 39.487875 41.0 40.0 41.0 36.5 41.0 24-25 39.44825 41.0 39.5 41.0 36.0 41.0 26-27 39.236999999999995 41.0 39.0 41.0 36.0 41.0 28-29 39.169375 41.0 39.0 41.0 36.0 41.0 30-31 38.976375000000004 41.0 39.0 41.0 35.5 41.0 32-33 39.147999999999996 41.0 39.0 41.0 36.0 41.0 34-35 39.244125 41.0 39.0 41.0 36.0 41.0 36-37 39.221000000000004 41.0 40.0 41.0 36.0 41.0 38-39 38.75725 40.5 38.5 41.0 34.5 41.0 40-41 38.621 40.0 38.5 41.0 34.5 41.0 42-43 38.84025 40.0 39.0 41.0 35.0 41.0 44-45 38.814499999999995 41.0 39.0 41.0 35.0 41.0 46-47 38.609375 40.0 38.5 41.0 34.5 41.0 48-49 38.401250000000005 40.0 38.5 41.0 34.5 41.0 50-51 38.18775 40.0 38.0 41.0 33.5 41.0 52-53 38.382999999999996 40.0 38.0 41.0 34.0 41.0 54-55 38.168625000000006 40.0 38.0 41.0 34.0 41.0 56-57 38.073750000000004 40.0 38.0 41.0 34.0 41.0 58-59 37.723625 40.0 37.0 41.0 33.5 41.0 60-61 37.220124999999996 39.0 36.0 41.0 32.5 41.0 62-63 37.11175 39.0 36.0 41.0 32.5 41.0 64-65 36.774625 39.0 35.5 40.0 31.5 41.0 66-67 36.510000000000005 38.5 35.0 40.0 31.5 41.0 68-69 36.120625000000004 37.5 35.0 40.0 31.0 41.0 70-71 35.3505 37.0 35.0 39.0 30.5 41.0 72-73 34.844375 36.0 34.0 39.0 29.5 40.0 74-75 34.495875 36.0 34.0 38.0 29.5 39.5 76-77 33.504374999999996 35.0 33.0 36.5 29.0 39.0 78-79 33.53175 35.0 34.0 37.0 29.0 39.0 80-81 33.59225 35.0 34.0 36.0 30.0 37.5 82-83 33.428250000000006 35.0 34.0 36.0 30.0 37.0 84-85 33.08525 35.0 34.0 36.0 29.0 37.0 86-87 32.63125 35.0 34.0 35.0 28.5 36.0 88-89 32.31825 35.0 33.0 35.0 27.0 36.0 90-91 32.354875 35.0 33.5 35.0 29.0 36.0 92-93 32.018875 35.0 33.0 35.0 27.0 35.5 94-95 31.800125 35.0 33.0 35.0 27.0 35.0 96-97 31.5835 35.0 33.0 35.0 25.5 35.0 98-99 31.445875 35.0 33.0 35.0 25.0 35.0 100 31.132 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 3.0 10 5.0 11 2.0 12 6.0 13 7.0 14 3.0 15 5.0 16 5.0 17 15.0 18 8.0 19 6.0 20 7.0 21 11.0 22 10.0 23 13.0 24 20.0 25 15.0 26 24.0 27 30.0 28 27.0 29 38.0 30 42.0 31 47.0 32 62.0 33 93.0 34 114.0 35 177.0 36 348.0 37 960.0 38 1622.0 39 273.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.09072478459199 14.267612772427777 15.585402939685759 43.05625950329448 2 21.375 21.349999999999998 35.425000000000004 21.85 3 21.65 25.55 25.224999999999998 27.575 4 25.424999999999997 30.525000000000002 19.725 24.325 5 23.875 35.475 21.7 18.95 6 19.075 38.574999999999996 23.200000000000003 19.15 7 17.825 20.3 41.075 20.8 8 18.6 26.55 29.325000000000003 25.525 9 19.45 24.025 33.0 23.525 10-11 22.650000000000002 33.225 23.5875 20.5375 12-13 20.474999999999998 26.9125 29.75 22.8625 14-15 21.7 28.549999999999997 27.712500000000002 22.037499999999998 16-17 21.325 29.125 27.725 21.825 18-19 21.7875 29.1875 26.474999999999998 22.55 20-21 22.162499999999998 28.299999999999997 27.8875 21.65 22-23 21.6625 28.712500000000002 27.1375 22.4875 24-25 21.837500000000002 28.125 27.6625 22.375 26-27 21.775 28.775000000000002 27.750000000000004 21.7 28-29 22.8 27.9125 27.0125 22.275 30-31 21.9 28.0875 27.6375 22.375 32-33 21.6625 27.987499999999997 27.750000000000004 22.6 34-35 21.325 28.175 28.287499999999998 22.2125 36-37 22.287499999999998 28.249999999999996 27.762500000000003 21.7 38-39 21.275 28.15 28.1375 22.4375 40-41 21.25 28.812500000000004 28.025 21.912499999999998 42-43 22.400000000000002 28.549999999999997 26.8625 22.1875 44-45 22.1375 28.3625 27.500000000000004 22.0 46-47 22.45 28.5625 27.375 21.6125 48-49 22.225 28.1125 27.212500000000002 22.45 50-51 21.298149074537267 28.826913456728363 27.851425712856425 22.02351175587794 52-53 21.87343671835918 28.289144572286144 27.03851925962982 22.798899449724864 54-55 21.2875 28.212500000000002 29.45 21.05 56-57 22.8125 27.737499999999997 27.6125 21.837500000000002 58-59 21.462500000000002 28.975 27.900000000000002 21.6625 60-61 21.85 28.050000000000004 28.012500000000003 22.0875 62-63 22.412499999999998 28.1125 28.050000000000004 21.425 64-65 22.1875 28.225 28.475 21.1125 66-67 22.3625 27.3 28.212500000000002 22.125 68-69 22.1 28.262500000000003 27.6125 22.025 70-71 22.3125 27.9375 27.5125 22.237499999999997 72-73 21.775 28.225 27.6375 22.3625 74-75 21.65 28.199999999999996 28.537499999999998 21.6125 76-77 21.4125 28.037499999999998 27.975 22.575 78-79 22.075 28.0875 28.3125 21.525 80-81 22.1375 28.575 28.1 21.1875 82-83 21.8875 28.0625 27.4125 22.6375 84-85 22.515314414301788 27.790973871733964 28.128516064508062 21.565195649456182 86-87 21.990248781097637 28.01600200025003 28.141017627203404 21.852731591448933 88-89 21.97197197197197 28.64114114114114 27.540040040040044 21.846846846846844 90-91 22.45995995995996 27.5025025025025 28.403403403403406 21.634134134134133 92-93 22.038774233896184 28.180112570356474 28.15509693558474 21.6260162601626 94-95 22.2125 27.962500000000002 28.549999999999997 21.275 96-97 21.75 27.487499999999997 28.262500000000003 22.5 98-99 21.65 27.8625 28.95 21.5375 100 21.875 27.525 27.525 23.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 2.5 26 5.5 27 6.5 28 8.5 29 11.0 30 13.0 31 19.5 32 29.0 33 38.5 34 53.5 35 76.0 36 99.5 37 111.0 38 132.5 39 170.0 40 200.5 41 239.5 42 241.0 43 250.5 44 271.5 45 260.0 46 266.0 47 259.5 48 233.5 49 208.0 50 165.0 51 132.5 52 119.0 53 91.0 54 64.5 55 47.5 56 37.0 57 30.5 58 24.0 59 20.0 60 14.5 61 9.5 62 12.0 63 8.0 64 2.0 65 2.0 66 1.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.5 72 1.5 73 1.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.05 52-53 0.05 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.0125 88-89 0.1 90-91 0.1 92-93 0.0625 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406705 spots for SRR3207882.sra Written 2406705 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra Read 2406702 spots for SRR3207882.sra Written 2406702 spots for SRR3207882.sra SRR ids: ['SRR3207882.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1tvqbwa4 SRR3207882.sra spots: 48134043 blocks: [[1, 2406702], [2406703, 4813404], [4813405, 7220106], [7220107, 9626808], [9626809, 12033510], [12033511, 14440212], [14440213, 16846914], [16846915, 19253616], [19253617, 21660318], [21660319, 24067020], [24067021, 26473722], [26473723, 28880424], [28880425, 31287126], [31287127, 33693828], [33693829, 36100530], [36100531, 38507232], [38507233, 40913934], [40913935, 43320636], [43320637, 45727338], [45727339, 48134043]] SRR3207882 file size 12515634 SRR3207882 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207882 SRR3207882_1.fastq Input file: SRR3207882_1.fastq trimmed: SRR3207882-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:19:26 2025 >> started Tue Feb 11 12:19:50 2025 >> done (24.005s) 48134043 reads processed; of these: 5959 ( 0.01%) short reads filtered out after trimming by size control 25204 ( 0.05%) empty reads filtered out after trimming by size control 48102880 (99.94%) reads available; of these: 4034084 ( 8.39%) trimmed reads available after processing 44068796 (91.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1170 0.00% 19 1442 0.00% 20 1771 0.00% 21 2566 0.01% 22 3395 0.01% 23 4565 0.01% 24 5945 0.01% 25 8189 0.02% 26 7922 0.02% 27 7965 0.02% 28 8200 0.02% 29 7771 0.02% 30 8107 0.02% 31 8120 0.02% 32 8290 0.02% 33 8648 0.02% 34 9478 0.02% 35 10008 0.02% 36 10811 0.02% 37 11250 0.02% 38 11917 0.02% 39 12634 0.03% 40 13366 0.03% 41 14210 0.03% 42 15115 0.03% 43 15961 0.03% 44 16594 0.03% 45 17337 0.04% 46 18405 0.04% 47 19300 0.04% 48 20514 0.04% 49 21420 0.04% 50 22843 0.05% 51 23767 0.05% 52 24050 0.05% 53 25739 0.05% 54 28114 0.06% 55 29256 0.06% 56 30901 0.06% 57 31461 0.07% 58 32119 0.07% 59 32172 0.07% 60 33053 0.07% 61 32870 0.07% 62 33795 0.07% 63 33732 0.07% 64 34197 0.07% 65 34666 0.07% 66 34901 0.07% 67 35537 0.07% 68 36514 0.08% 69 37491 0.08% 70 37628 0.08% 71 38903 0.08% 72 40414 0.08% 73 41190 0.09% 74 42148 0.09% 75 41324 0.09% 76 29630 0.06% 77 33815 0.07% 78 38387 0.08% 79 42222 0.09% 80 46292 0.10% 81 49870 0.10% 82 53592 0.11% 83 60135 0.13% 84 60611 0.13% 85 65944 0.14% 86 70809 0.15% 87 80278 0.17% 88 83545 0.17% 89 90878 0.19% 90 101567 0.21% 91 111237 0.23% 92 127582 0.27% 93 147389 0.31% 94 172355 0.36% 95 198223 0.41% 96 239626 0.50% 97 280465 0.58% 98 321618 0.67% 99 326843 0.68% 100 44068796 91.61% 48102880 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=20 prefix-density=0.02 prefix-fanout=3.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=216.49 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.3 sequence=AAGAAGAAGAAA Started job on | Feb 11 12:20:08 Started mapping on | Feb 11 12:20:08 Finished on | Feb 11 12:20:51 Mapping speed, Million of reads per hour | 4027.22 Number of input reads | 48102880 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 45308352 Uniquely mapped reads % | 94.19% Average mapped length | 98.28 Number of splices: Total | 12509899 Number of splices: Annotated (sjdb) | 12268609 Number of splices: GT/AG | 12315011 Number of splices: GC/AG | 159928 Number of splices: AT/AC | 13648 Number of splices: Non-canonical | 21312 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 1.95 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1212289 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 1083914 % of reads mapped to too many loci | 2.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1582239 1582239 1582239 N_multimapping 1212289 1212289 1212289 N_noFeature 1799205 23224135 23525852 N_ambiguous 521654 82111 82739 UnstrandedReadsAssigned:42987493 PositiveStrandReadsAssigned:22002106 NegativeStrandReadsAssigned:21699761 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207882 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207882-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,102,880 reads, 44,893,034 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,305 rounds 52401 SRR3207882.ke.tsv 34699 SRR3207882.se.tsv 87100 total ==> SRR3207882.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2736 43.7944 Potri.005G024800.1.v4.1 1035 936 2474 81.1897 Potri.004G059700.1.v4.1 961 862 218 7.76831 Potri.007G009000.2.v4.1 1416 1317 3 0.0699701 Potri.003G141000.2.v4.1 2943 2844 1157.26 12.4991 Potri.016G087400.1.v4.1 270 171 2312 415.307 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 142 2.60561 Potri.012G127500.1.v4.1 977 878 3705 129.62 ==> SRR3207882.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5550 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 725 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 106 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR3207882 completed mapping pipeline successfully