Starting /dee2/code/volunteer_pipeline.sh SRR3207883 current disk space = 3051728416768 free memory = 1190775064 SRR3207883 SRAfilesize b1bc92623a795eae9d604668250903c8 SRR3207883.sra SRR3207883.sra file validated SRR3207883 is single end SRR3207883 is conventional basespace SRR3207883 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207883_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9985 34.0 31.0 34.0 31.0 34.0 2 33.01775 34.0 33.0 34.0 31.0 34.0 3 33.108 34.0 33.0 34.0 31.0 34.0 4 36.3995 37.0 37.0 37.0 35.0 37.0 5 36.3195 37.0 37.0 37.0 35.0 37.0 6 36.3645 37.0 37.0 37.0 35.0 37.0 7 36.38025 37.0 37.0 37.0 35.0 37.0 8 36.36025 37.0 37.0 37.0 35.0 37.0 9 38.16025 39.0 39.0 39.0 37.0 39.0 10-11 38.204125 39.0 39.0 39.0 37.0 39.0 12-13 38.153875 39.0 39.0 39.0 37.0 39.0 14-15 39.739999999999995 41.0 40.0 41.0 37.0 41.0 16-17 39.750875 41.0 40.0 41.0 37.5 41.0 18-19 39.647875 41.0 40.0 41.0 37.0 41.0 20-21 39.584500000000006 41.0 40.0 41.0 37.0 41.0 22-23 39.649 41.0 40.0 41.0 37.0 41.0 24-25 39.377875 41.0 40.0 41.0 37.0 41.0 26-27 39.537625 41.0 40.0 41.0 37.0 41.0 28-29 39.36425 41.0 39.5 41.0 36.0 41.0 30-31 39.355875 41.0 39.5 41.0 36.5 41.0 32-33 39.307125 41.0 39.0 41.0 36.5 41.0 34-35 39.14125 41.0 39.0 41.0 36.0 41.0 36-37 39.100750000000005 41.0 39.0 41.0 36.0 41.0 38-39 38.980125 40.0 39.0 41.0 36.0 41.0 40-41 38.872625 40.0 39.0 41.0 35.0 41.0 42-43 38.80225 40.0 39.0 41.0 35.0 41.0 44-45 38.594875 40.0 38.0 41.0 35.0 41.0 46-47 38.460125000000005 40.0 38.0 41.0 34.5 41.0 48-49 38.454625 40.0 38.0 41.0 35.0 41.0 50-51 38.312125 40.0 38.0 41.0 34.0 41.0 52-53 38.087 40.0 38.0 41.0 33.0 41.0 54-55 38.022125 40.0 38.0 41.0 33.5 41.0 56-57 37.8775 40.0 37.5 41.0 33.0 41.0 58-59 37.6265 40.0 37.0 41.0 33.0 41.0 60-61 37.67825 39.5 37.0 41.0 33.0 41.0 62-63 37.74325 40.0 37.0 41.0 34.0 41.0 64-65 37.616875 39.0 36.5 41.0 34.0 41.0 66-67 37.165125 39.0 35.5 41.0 33.0 41.0 68-69 36.689125000000004 38.5 35.0 40.0 32.5 41.0 70-71 36.266125 37.0 35.0 39.5 32.0 41.0 72-73 35.970375000000004 37.0 35.0 39.0 32.0 41.0 74-75 35.47025 36.0 35.0 39.0 31.5 40.0 76-77 33.912499999999994 35.0 33.0 37.0 29.5 39.0 78-79 34.491749999999996 35.0 34.0 37.0 31.0 39.0 80-81 34.327625 35.0 34.5 37.0 31.0 38.5 82-83 33.979749999999996 35.0 34.0 36.0 31.0 37.0 84-85 33.814375 35.0 34.0 36.0 31.0 37.0 86-87 33.585625 35.0 34.0 35.5 31.0 36.5 88-89 33.350375 35.0 34.0 35.0 30.5 36.0 90-91 33.143625 35.0 34.0 35.0 30.0 36.0 92-93 33.028999999999996 35.0 34.0 35.0 30.0 36.0 94-95 32.931375 35.0 34.0 35.0 30.0 35.5 96-97 32.54525 35.0 34.0 35.0 29.5 35.0 98-99 32.345 35.0 34.0 35.0 29.0 35.0 100 32.26325 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 5.0 11 2.0 12 4.0 13 5.0 14 3.0 15 4.0 16 6.0 17 5.0 18 4.0 19 6.0 20 6.0 21 8.0 22 5.0 23 9.0 24 6.0 25 7.0 26 13.0 27 19.0 28 26.0 29 30.0 30 32.0 31 51.0 32 72.0 33 89.0 34 117.0 35 189.0 36 357.0 37 929.0 38 1617.0 39 370.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.374999999999996 14.674999999999999 17.75 42.199999999999996 2 21.099999999999998 22.8 35.55 20.549999999999997 3 23.200000000000003 26.025 27.875 22.900000000000002 4 24.575 31.4 21.975 22.05 5 23.65 36.075 22.375 17.9 6 18.525 35.949999999999996 24.875 20.65 7 17.025000000000002 17.2 44.3 21.475 8 19.3 23.025000000000002 30.099999999999998 27.575 9 20.075000000000003 24.099999999999998 32.05 23.775 10-11 22.875 33.1625 22.2 21.762500000000003 12-13 20.549999999999997 26.737499999999997 29.5875 23.125 14-15 20.875 27.900000000000002 29.025000000000002 22.2 16-17 21.9625 28.050000000000004 27.775 22.2125 18-19 22.075 28.512500000000003 27.437499999999996 21.975 20-21 21.98324371639365 27.635363261222956 27.46029761160435 22.921095410779042 22-23 21.8625 28.375 27.6 22.162499999999998 24-25 22.360326428123038 28.688010043942246 27.31952291274325 21.63214061519146 26-27 22.1375 28.425 27.187499999999996 22.25 28-29 21.3875 27.787499999999998 27.8375 22.9875 30-31 21.525 28.525 27.650000000000002 22.3 32-33 22.5 28.15 27.5875 21.762500000000003 34-35 21.2875 28.8375 27.675 22.2 36-37 21.525 28.625 27.487499999999997 22.3625 38-39 22.5125 28.15 27.712500000000002 21.625 40-41 21.275 28.775000000000002 27.35 22.6 42-43 22.625 28.749999999999996 27.224999999999998 21.4 44-45 22.9875 28.175 27.5875 21.25 46-47 21.9375 27.9125 28.1375 22.0125 48-49 21.192718141870685 29.127432517263024 27.95982423101067 21.720025109855616 50-51 22.19849246231156 28.27889447236181 27.474874371859297 22.047738693467338 52-53 22.081821593894656 28.24971850369073 28.137119979982483 21.531339922432128 54-55 21.9 27.987499999999997 28.275 21.837500000000002 56-57 22.175 28.199999999999996 27.625 22.0 58-59 21.7375 28.575 28.325 21.3625 60-61 21.837500000000002 28.7 26.35 23.1125 62-63 21.9625 28.6625 27.6875 21.6875 64-65 22.925 28.1875 26.924999999999997 21.9625 66-67 22.59032379047381 28.853606700837602 27.00337542192774 21.552694086760845 68-69 22.2430607651913 27.44436109027257 28.26956739184796 22.043010752688172 70-71 22.775000000000002 28.1625 27.287499999999998 21.775 72-73 22.425 27.487499999999997 28.6625 21.425 74-75 21.475 27.325 28.4125 22.787499999999998 76-77 22.1375 28.8375 27.400000000000002 21.625 78-79 22.537499999999998 28.212500000000002 27.462500000000002 21.7875 80-81 22.2625 29.349999999999998 26.987499999999997 21.4 82-83 21.7875 27.85 27.8875 22.475 84-85 21.955488872218055 27.344336084021002 28.432108027006752 22.268067016754188 86-87 22.3 27.575 28.787499999999998 21.337500000000002 88-89 23.1 27.5125 28.000000000000004 21.3875 90-91 21.8875 28.525 27.712500000000002 21.875 92-93 21.332999874953106 29.473552582218332 27.91046642490934 21.28298111791922 94-95 22.898949474737368 28.526763381690845 27.07603801900951 21.498249124562278 96-97 22.400000000000002 28.287499999999998 26.8375 22.475 98-99 22.193048262065513 28.107026756689173 27.619404851212803 22.080520130032507 100 23.54265699274456 27.145359019264447 27.995996997748314 21.31598699024268 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 1.5 25 4.5 26 4.0 27 6.5 28 10.0 29 13.0 30 23.5 31 35.5 32 40.0 33 40.5 34 53.0 35 80.5 36 96.5 37 121.5 38 143.0 39 155.5 40 192.0 41 212.0 42 233.0 43 262.0 44 272.0 45 263.5 46 251.5 47 229.5 48 210.0 49 195.5 50 161.5 51 131.5 52 109.5 53 96.0 54 73.5 55 52.0 56 49.5 57 38.0 58 22.5 59 14.5 60 13.5 61 15.0 62 11.5 63 8.5 64 6.5 65 5.5 66 5.0 67 5.0 68 6.0 69 3.0 70 1.5 71 2.5 72 1.0 73 0.5 74 2.0 75 3.0 76 1.5 77 0.5 78 1.5 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0375 22-23 0.0 24-25 0.43750000000000006 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.43750000000000006 50-51 0.5 52-53 0.08750000000000001 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0125 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.025 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0375 94-95 0.05 96-97 0.0 98-99 0.025 100 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651696 spots for SRR3207883.sra Written 651696 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra Read 651688 spots for SRR3207883.sra Written 651688 spots for SRR3207883.sra SRR ids: ['SRR3207883.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o5nhk7mi SRR3207883.sra spots: 13033768 blocks: [[1, 651688], [651689, 1303376], [1303377, 1955064], [1955065, 2606752], [2606753, 3258440], [3258441, 3910128], [3910129, 4561816], [4561817, 5213504], [5213505, 5865192], [5865193, 6516880], [6516881, 7168568], [7168569, 7820256], [7820257, 8471944], [8471945, 9123632], [9123633, 9775320], [9775321, 10427008], [10427009, 11078696], [11078697, 11730384], [11730385, 12382072], [12382073, 13033768]] SRR3207883 file size 3381092 SRR3207883 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207883 SRR3207883_1.fastq Input file: SRR3207883_1.fastq trimmed: SRR3207883-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:23:27 2025 >> started Tue Feb 11 11:23:36 2025 >> done (9.756s) 13033768 reads processed; of these: 1532 ( 0.01%) short reads filtered out after trimming by size control 16006 ( 0.12%) empty reads filtered out after trimming by size control 13016230 (99.87%) reads available; of these: 610798 ( 4.69%) trimmed reads available after processing 12405432 (95.31%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 231 0.00% 19 262 0.00% 20 348 0.00% 21 419 0.00% 22 588 0.00% 23 831 0.01% 24 1172 0.01% 25 1498 0.01% 26 1642 0.01% 27 1680 0.01% 28 1614 0.01% 29 1654 0.01% 30 1649 0.01% 31 1649 0.01% 32 1798 0.01% 33 1718 0.01% 34 1846 0.01% 35 1943 0.01% 36 2060 0.02% 37 2048 0.02% 38 2162 0.02% 39 2254 0.02% 40 2324 0.02% 41 2404 0.02% 42 2523 0.02% 43 2662 0.02% 44 2801 0.02% 45 2931 0.02% 46 2933 0.02% 47 3006 0.02% 48 3029 0.02% 49 3167 0.02% 50 3242 0.02% 51 3397 0.03% 52 3570 0.03% 53 3903 0.03% 54 3852 0.03% 55 4195 0.03% 56 3758 0.03% 57 3945 0.03% 58 3961 0.03% 59 3914 0.03% 60 4045 0.03% 61 4265 0.03% 62 4517 0.03% 63 4772 0.04% 64 5665 0.04% 65 5205 0.04% 66 5615 0.04% 67 5738 0.04% 68 6473 0.05% 69 5006 0.04% 70 5286 0.04% 71 5544 0.04% 72 5830 0.04% 73 6290 0.05% 74 6499 0.05% 75 6854 0.05% 76 3792 0.03% 77 4351 0.03% 78 5321 0.04% 79 6020 0.05% 80 6338 0.05% 81 6839 0.05% 82 7372 0.06% 83 7801 0.06% 84 8396 0.06% 85 9214 0.07% 86 9719 0.07% 87 10647 0.08% 88 11603 0.09% 89 12257 0.09% 90 13993 0.11% 91 16568 0.13% 92 19629 0.15% 93 21143 0.16% 94 23739 0.18% 95 28345 0.22% 96 34477 0.26% 97 43446 0.33% 98 52400 0.40% 99 63201 0.49% 100 12405432 95.31% 13016230 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=62.91 fanout-score-rank=8 prefix-density=1.32 prefix-fanout=43.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=3 fanout-score=233.34 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=24.1 sequence=AAGAAGAAGAAA Started job on | Feb 11 11:23:55 Started mapping on | Feb 11 11:23:55 Finished on | Feb 11 11:24:14 Mapping speed, Million of reads per hour | 2466.23 Number of input reads | 13016230 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12015016 Uniquely mapped reads % | 92.31% Average mapped length | 98.67 Number of splices: Total | 3365505 Number of splices: Annotated (sjdb) | 3294600 Number of splices: GT/AG | 3311318 Number of splices: GC/AG | 44039 Number of splices: AT/AC | 3541 Number of splices: Non-canonical | 6607 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.07 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379572 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 309340 % of reads mapped to too many loci | 2.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 621642 621642 621642 N_multimapping 379572 379572 379572 N_noFeature 581379 6218295 6299214 N_ambiguous 126177 23755 23741 UnstrandedReadsAssigned:11307460 PositiveStrandReadsAssigned:5772966 NegativeStrandReadsAssigned:5692061 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207883 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207883-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,016,230 reads, 11,878,040 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR3207883.ke.tsv 34699 SRR3207883.se.tsv 87100 total ==> SRR3207883.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1170 68.0258 Potri.005G024800.1.v4.1 1035 936 1092 130.17 Potri.004G059700.1.v4.1 961 862 14 1.81211 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 345.145 13.5405 Potri.016G087400.1.v4.1 270 171 454 296.226 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 247.793 16.5157 Potri.012G127500.1.v4.1 977 878 1895 240.812 ==> SRR3207883.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 971 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR3207883 completed mapping pipeline successfully