Starting /dee2/code/volunteer_pipeline.sh SRR3207884 current disk space = 3051713728512 free memory = 1434002368 SRR3207884 SRAfilesize 07db898f70283d632dad1a50476f4ff9 SRR3207884.sra SRR3207884.sra file validated SRR3207884 is single end SRR3207884 is conventional basespace SRR3207884 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207884_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01625 34.0 33.0 34.0 31.0 34.0 2 33.05175 34.0 33.0 34.0 31.0 34.0 3 33.16125 34.0 33.0 34.0 31.0 34.0 4 36.4775 37.0 37.0 37.0 35.0 37.0 5 36.383 37.0 37.0 37.0 35.0 37.0 6 36.34575 37.0 37.0 37.0 35.0 37.0 7 36.3645 37.0 37.0 37.0 35.0 37.0 8 36.365 37.0 37.0 37.0 35.0 37.0 9 38.20775 39.0 39.0 39.0 37.0 39.0 10-11 38.161875 39.0 39.0 39.0 37.0 39.0 12-13 38.161625 39.0 39.0 39.0 37.0 39.0 14-15 39.836875 41.0 40.0 41.0 38.0 41.0 16-17 39.741625 41.0 40.0 41.0 37.5 41.0 18-19 39.68925 41.0 40.0 41.0 37.5 41.0 20-21 39.5895 41.0 40.0 41.0 37.0 41.0 22-23 39.73125 41.0 40.0 41.0 37.5 41.0 24-25 39.082875 41.0 40.0 41.0 36.5 41.0 26-27 39.41775 41.0 40.0 41.0 36.5 41.0 28-29 39.423500000000004 41.0 39.5 41.0 37.0 41.0 30-31 39.328125 41.0 39.5 41.0 36.5 41.0 32-33 39.171625 41.0 39.0 41.0 36.0 41.0 34-35 39.08425 41.0 39.0 41.0 36.0 41.0 36-37 39.11024999999999 41.0 39.0 41.0 36.0 41.0 38-39 38.988625 40.0 39.0 41.0 35.0 41.0 40-41 38.82575 40.0 38.5 41.0 35.0 41.0 42-43 38.72225 40.0 38.0 41.0 35.0 41.0 44-45 38.654250000000005 40.0 38.0 41.0 35.0 41.0 46-47 38.340125 40.0 38.0 41.0 34.5 41.0 48-49 37.923625 40.0 38.0 41.0 33.5 41.0 50-51 37.846125 40.0 38.0 41.0 33.0 41.0 52-53 37.76925 40.0 37.5 41.0 33.0 41.0 54-55 37.85475 40.0 37.0 41.0 33.0 41.0 56-57 37.826499999999996 40.0 37.0 41.0 33.5 41.0 58-59 37.385875 39.5 36.5 41.0 32.0 41.0 60-61 37.441625 39.0 36.5 41.0 32.5 41.0 62-63 37.501125 39.0 36.0 41.0 33.0 41.0 64-65 37.350875 39.0 36.0 41.0 33.0 41.0 66-67 36.930625 39.0 35.5 41.0 32.5 41.0 68-69 36.610875 37.5 35.0 40.0 32.0 41.0 70-71 36.131125 37.0 35.0 39.5 32.0 41.0 72-73 35.796625 36.5 35.0 39.0 32.0 41.0 74-75 35.310874999999996 36.0 35.0 39.0 31.5 40.5 76-77 33.79475 35.0 33.0 37.0 29.5 39.0 78-79 34.386875 35.0 34.0 37.0 31.0 39.0 80-81 34.25375 35.0 34.0 36.5 31.0 38.0 82-83 33.807249999999996 35.0 34.0 36.0 30.0 37.0 84-85 33.698125000000005 35.0 34.0 36.0 31.0 37.0 86-87 33.417125 35.0 34.0 35.0 30.0 36.5 88-89 33.286125 35.0 34.0 35.0 30.0 36.0 90-91 33.010875 35.0 34.0 35.0 29.0 36.0 92-93 32.992875 35.0 34.0 35.0 29.5 36.0 94-95 32.94025 35.0 34.0 35.0 30.0 36.0 96-97 32.508 35.0 34.0 35.0 28.5 35.0 98-99 32.301625 35.0 34.0 35.0 29.0 35.0 100 32.133 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 1.0 7 2.0 8 2.0 9 4.0 10 0.0 11 5.0 12 3.0 13 5.0 14 4.0 15 2.0 16 4.0 17 3.0 18 1.0 19 3.0 20 8.0 21 9.0 22 7.0 23 7.0 24 4.0 25 10.0 26 12.0 27 19.0 28 31.0 29 39.0 30 38.0 31 58.0 32 64.0 33 100.0 34 146.0 35 207.0 36 388.0 37 890.0 38 1539.0 39 382.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.85 15.8 16.375 41.975 2 20.875 22.900000000000002 35.699999999999996 20.525 3 23.150000000000002 25.775 27.0 24.075 4 23.625 33.275 20.375 22.725 5 25.4 33.975 23.175 17.45 6 20.424999999999997 36.025 23.1 20.45 7 16.35 18.675 44.025 20.95 8 19.125 21.675 31.05 28.15 9 20.05 22.925 30.8 26.224999999999998 10-11 23.2375 32.9375 21.987499999999997 21.837500000000002 12-13 20.5375 26.85 29.325000000000003 23.2875 14-15 21.85 27.762500000000003 28.3125 22.075 16-17 22.725 27.787499999999998 27.1625 22.325 18-19 22.7125 27.0875 27.775 22.425 20-21 22.29307326831708 27.86946736684171 27.60690172543136 22.230557639409852 22-23 21.925 28.0875 27.487499999999997 22.5 24-25 21.446604392830093 28.66700328199949 27.745518808381718 22.14087351678869 26-27 23.25 28.025 26.450000000000003 22.275 28-29 22.5625 27.8375 27.500000000000004 22.1 30-31 21.8875 27.962500000000002 27.425 22.725 32-33 22.15 28.8625 27.0625 21.925 34-35 22.8375 27.725 27.0875 22.35 36-37 22.3125 28.599999999999998 26.5375 22.55 38-39 21.575 29.099999999999998 26.937499999999996 22.3875 40-41 22.5875 28.325 27.0 22.0875 42-43 21.525 27.750000000000004 28.012500000000003 22.7125 44-45 22.237499999999997 28.287499999999998 27.675 21.8 46-47 22.8375 27.625 27.900000000000002 21.637500000000003 48-49 23.469129554655872 27.631578947368425 26.78390688259109 22.115384615384613 50-51 22.638642694353 27.589263104583438 27.32337300582426 22.4487211952393 52-53 21.95336008024072 28.410230692076226 28.046639919759276 21.58976930792377 54-55 23.102887860982623 27.61595199399925 27.103387923490434 22.177772221527693 56-57 21.837500000000002 28.7 27.212500000000002 22.25 58-59 22.525000000000002 27.650000000000002 27.6625 22.162499999999998 60-61 21.95 28.487499999999997 27.287499999999998 22.275 62-63 22.35 27.500000000000004 28.212500000000002 21.9375 64-65 23.51543942992874 26.978372296537067 28.378547318414803 21.12764095511939 66-67 23.56544568071009 27.528441055131893 27.090886360795096 21.81522690336292 68-69 22.643160790197552 27.419354838709676 28.419604901225306 21.517879469867466 70-71 22.075 28.237499999999997 27.712500000000002 21.975 72-73 22.9625 28.199999999999996 27.125 21.712500000000002 74-75 21.425 28.1875 28.050000000000004 22.3375 76-77 22.5875 27.975 27.55 21.8875 78-79 22.775000000000002 28.037499999999998 27.450000000000003 21.7375 80-81 23.3375 27.787499999999998 26.8 22.075 82-83 22.400000000000002 27.6 27.437499999999996 22.5625 84-85 22.452806600825102 28.378547318414803 26.59082385298162 22.577822227778473 86-87 22.912499999999998 28.6375 26.9625 21.4875 88-89 22.775000000000002 27.474999999999998 27.750000000000004 22.0 90-91 22.975 28.1 26.875 22.05 92-93 22.2430607651913 28.369592398099524 27.544386096524132 21.842960740185045 94-95 23.571339252219584 27.72289608603226 27.160185069401027 21.54557959234713 96-97 23.165395674459308 28.51606450806351 27.778472309038634 20.540067508438558 98-99 23.39042380297537 28.403550443805475 26.2782847855982 21.927740967620952 100 22.836418209104554 28.61430715357679 26.388194097048522 22.161080540270135 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.0 24 1.0 25 1.0 26 1.0 27 3.5 28 7.0 29 10.5 30 15.0 31 21.5 32 35.0 33 47.5 34 60.0 35 66.5 36 86.5 37 127.5 38 139.0 39 156.0 40 189.5 41 213.0 42 235.5 43 236.5 44 238.0 45 259.0 46 251.0 47 240.0 48 229.0 49 188.5 50 160.0 51 143.0 52 120.0 53 97.0 54 76.5 55 57.0 56 46.0 57 41.0 58 34.0 59 31.0 60 26.5 61 20.5 62 17.0 63 11.5 64 9.5 65 7.0 66 3.5 67 3.0 68 2.5 69 3.5 70 4.0 71 2.5 72 4.0 73 3.5 74 3.0 75 3.0 76 2.0 77 2.0 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.025 22-23 0.0 24-25 0.975 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 1.2 50-51 1.275 52-53 0.3 54-55 0.0125 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0125 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0375 96-97 0.0125 98-99 0.0125 100 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7063572149344097 1.4000000000000001 3 0.10090817356205853 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.48750000000000004 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.8500000000000001 0.0 0.0 0.0 0.0 86-87 1.05 0.0 0.0 0.0 0.0 88 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067758 spots for SRR3207884.sra Written 1067758 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra Read 1067742 spots for SRR3207884.sra Written 1067742 spots for SRR3207884.sra SRR ids: ['SRR3207884.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5jk5jv19 SRR3207884.sra spots: 21354856 blocks: [[1, 1067742], [1067743, 2135484], [2135485, 3203226], [3203227, 4270968], [4270969, 5338710], [5338711, 6406452], [6406453, 7474194], [7474195, 8541936], [8541937, 9609678], [9609679, 10677420], [10677421, 11745162], [11745163, 12812904], [12812905, 13880646], [13880647, 14948388], [14948389, 16016130], [16016131, 17083872], [17083873, 18151614], [18151615, 19219356], [19219357, 20287098], [20287099, 21354856]] SRR3207884 file size 5546587 SRR3207884 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207884 SRR3207884_1.fastq Input file: SRR3207884_1.fastq trimmed: SRR3207884-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:32:24 2025 >> started Tue Feb 11 11:32:35 2025 >> done (10.459s) 21354856 reads processed; of these: 2385 ( 0.01%) short reads filtered out after trimming by size control 33349 ( 0.16%) empty reads filtered out after trimming by size control 21319122 (99.83%) reads available; of these: 948769 ( 4.45%) trimmed reads available after processing 20370353 (95.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 344 0.00% 19 482 0.00% 20 609 0.00% 21 730 0.00% 22 976 0.00% 23 1363 0.01% 24 1760 0.01% 25 2389 0.01% 26 2326 0.01% 27 2476 0.01% 28 2481 0.01% 29 2609 0.01% 30 2728 0.01% 31 2760 0.01% 32 2884 0.01% 33 2865 0.01% 34 3154 0.01% 35 3130 0.01% 36 3358 0.02% 37 3482 0.02% 38 3486 0.02% 39 3548 0.02% 40 3938 0.02% 41 3937 0.02% 42 4301 0.02% 43 4276 0.02% 44 4536 0.02% 45 4638 0.02% 46 4659 0.02% 47 4542 0.02% 48 4752 0.02% 49 5034 0.02% 50 5145 0.02% 51 5273 0.02% 52 5350 0.03% 53 6041 0.03% 54 5856 0.03% 55 6217 0.03% 56 5652 0.03% 57 5843 0.03% 58 5973 0.03% 59 6199 0.03% 60 5888 0.03% 61 6845 0.03% 62 7211 0.03% 63 7475 0.04% 64 8905 0.04% 65 8065 0.04% 66 9006 0.04% 67 9142 0.04% 68 10163 0.05% 69 7632 0.04% 70 7961 0.04% 71 8583 0.04% 72 8930 0.04% 73 9601 0.05% 74 9759 0.05% 75 10681 0.05% 76 5503 0.03% 77 6459 0.03% 78 7865 0.04% 79 8782 0.04% 80 9522 0.04% 81 10367 0.05% 82 11156 0.05% 83 11725 0.05% 84 12750 0.06% 85 13890 0.07% 86 14953 0.07% 87 16748 0.08% 88 17864 0.08% 89 18914 0.09% 90 21741 0.10% 91 25649 0.12% 92 30803 0.14% 93 32918 0.15% 94 36367 0.17% 95 43868 0.21% 96 52747 0.25% 97 68566 0.32% 98 82177 0.39% 99 99486 0.47% 100 20370353 95.55% 21319122 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=61.44 fanout-score-rank=1 prefix-density=1.60 prefix-fanout=43.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=1.13 sequence-density-rank=1 fanout-score=61.44 fanout-score-rank=1 prefix-density=1.60 prefix-fanout=43.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Started job on | Feb 11 11:32:53 Started mapping on | Feb 11 11:32:53 Finished on | Feb 11 11:33:19 Mapping speed, Million of reads per hour | 2951.88 Number of input reads | 21319122 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 18685767 Uniquely mapped reads % | 87.65% Average mapped length | 98.67 Number of splices: Total | 5329398 Number of splices: Annotated (sjdb) | 5210780 Number of splices: GT/AG | 5240735 Number of splices: GC/AG | 71133 Number of splices: AT/AC | 6063 Number of splices: Non-canonical | 11467 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.07 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 667571 % of reads mapped to multiple loci | 3.13% Number of reads mapped to too many loci | 1831238 % of reads mapped to too many loci | 8.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.62% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1965784 1965784 1965784 N_multimapping 667571 667571 667571 N_noFeature 1011763 9729017 9863035 N_ambiguous 181706 38514 38115 UnstrandedReadsAssigned:17492298 PositiveStrandReadsAssigned:8918236 NegativeStrandReadsAssigned:8784617 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207884 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207884-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,319,122 reads, 19,558,065 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,269 rounds 52401 SRR3207884.ke.tsv 34699 SRR3207884.se.tsv 87100 total ==> SRR3207884.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1234 42.3908 Potri.005G024800.1.v4.1 1035 936 1076 75.7824 Potri.004G059700.1.v4.1 961 862 31 2.37075 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 551.174 12.7759 Potri.016G087400.1.v4.1 270 171 714 275.254 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 110 4.33181 Potri.012G127500.1.v4.1 977 878 6335 475.646 ==> SRR3207884.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 913 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR3207884 completed mapping pipeline successfully