Starting /dee2/code/volunteer_pipeline.sh SRR3207885 current disk space = 3051760873472 free memory = 1456021452 SRR3207885 SRAfilesize 282265338da33f37926f89bb8740cc78 SRR3207885.sra SRR3207885.sra file validated SRR3207885 is single end SRR3207885 is conventional basespace SRR3207885 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207885_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78125 34.0 33.0 34.0 31.0 34.0 2 33.1455 34.0 34.0 34.0 31.0 34.0 3 33.4085 34.0 34.0 34.0 31.0 34.0 4 36.6745 37.0 37.0 37.0 35.0 37.0 5 36.55325 37.0 37.0 37.0 35.0 37.0 6 36.61525 37.0 37.0 37.0 35.0 37.0 7 36.6345 37.0 37.0 37.0 35.0 37.0 8 36.6465 37.0 37.0 37.0 35.0 37.0 9 38.5525 39.0 39.0 39.0 38.0 39.0 10-11 38.585375 39.0 39.0 39.0 38.0 39.0 12-13 38.529375 39.0 39.0 39.0 38.0 39.0 14-15 40.283 41.0 40.5 41.0 39.0 41.0 16-17 40.257999999999996 41.0 40.0 41.0 39.0 41.0 18-19 40.18925 41.0 40.0 41.0 38.5 41.0 20-21 40.214749999999995 41.0 40.0 41.0 39.0 41.0 22-23 40.16075 41.0 40.0 41.0 39.0 41.0 24-25 40.115125000000006 41.0 40.0 41.0 38.5 41.0 26-27 40.0185 41.0 40.0 41.0 38.0 41.0 28-29 39.8585 41.0 40.0 41.0 38.0 41.0 30-31 39.897 41.0 40.0 41.0 38.0 41.0 32-33 39.828125 41.0 40.0 41.0 38.0 41.0 34-35 39.76225 41.0 40.0 41.0 38.0 41.0 36-37 39.601 41.0 40.0 41.0 37.5 41.0 38-39 39.518875 41.0 40.0 41.0 37.0 41.0 40-41 39.45225 41.0 40.0 41.0 37.0 41.0 42-43 39.37975 41.0 40.0 41.0 37.0 41.0 44-45 39.24375 41.0 39.5 41.0 36.5 41.0 46-47 39.239125 41.0 40.0 41.0 36.5 41.0 48-49 39.2635 41.0 40.0 41.0 36.0 41.0 50-51 39.15075 41.0 39.0 41.0 36.0 41.0 52-53 39.0125 41.0 39.0 41.0 35.0 41.0 54-55 38.882625000000004 40.5 39.0 41.0 35.0 41.0 56-57 38.907875000000004 41.0 39.0 41.0 35.0 41.0 58-59 38.8705 41.0 39.0 41.0 35.0 41.0 60-61 38.711875000000006 40.5 38.5 41.0 35.0 41.0 62-63 38.466499999999996 40.0 37.5 41.0 35.0 41.0 64-65 38.210750000000004 39.5 37.0 41.0 35.0 41.0 66-67 37.795375 39.0 36.5 41.0 35.0 41.0 68-69 37.228125000000006 39.0 36.0 41.0 34.0 41.0 70-71 36.96325 37.5 35.0 40.0 34.0 41.0 72-73 36.442375 37.0 35.0 39.0 34.0 41.0 74-75 36.0155 36.5 35.0 39.0 33.5 41.0 76-77 34.407250000000005 35.0 33.5 37.0 30.5 39.0 78-79 35.11125 36.0 35.0 37.0 33.0 39.0 80-81 34.929 35.0 35.0 37.0 33.0 39.0 82-83 34.711375000000004 35.0 35.0 36.0 33.5 37.0 84-85 34.43025 35.0 35.0 36.0 33.0 37.0 86-87 34.216 35.0 35.0 36.0 33.0 37.0 88-89 34.069375 35.0 35.0 35.0 33.0 36.0 90-91 33.941874999999996 35.0 35.0 35.0 33.0 36.0 92-93 33.754374999999996 35.0 35.0 35.0 32.5 36.0 94-95 33.642125 35.0 35.0 35.0 32.0 36.0 96-97 33.539875 35.0 35.0 35.0 32.5 36.0 98-99 33.48975 35.0 35.0 35.0 32.5 35.0 100 33.399 35.0 35.0 35.0 32.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 4.0 10 1.0 11 2.0 12 0.0 13 7.0 14 4.0 15 2.0 16 4.0 17 4.0 18 5.0 19 1.0 20 4.0 21 3.0 22 6.0 23 7.0 24 4.0 25 4.0 26 18.0 27 10.0 28 9.0 29 13.0 30 15.0 31 27.0 32 46.0 33 37.0 34 70.0 35 119.0 36 242.0 37 732.0 38 1973.0 39 622.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.471606824548 16.297428062133946 16.475681181563534 42.75528393175452 2 19.950000000000003 23.674999999999997 36.65 19.725 3 23.05 27.125 26.974999999999998 22.85 4 25.55 32.800000000000004 18.45 23.200000000000003 5 25.081270317579396 35.8589647411853 20.705176294073517 18.35458864716179 6 18.25 38.6 22.975 20.175 7 17.775 18.4 42.65 21.175 8 18.175 23.375 30.25 28.199999999999996 9 21.475 22.575 31.175000000000004 24.775 10-11 22.5625 33.300000000000004 22.3125 21.825 12-13 20.925 26.525 29.375 23.175 14-15 20.575 27.537499999999998 29.375 22.5125 16-17 22.375 27.0 27.3625 23.2625 18-19 21.8875 29.1375 26.900000000000002 22.075 20-21 21.4875 28.237499999999997 27.425 22.85 22-23 21.6625 27.212500000000002 28.7 22.425 24-25 21.625 27.3875 27.925 23.0625 26-27 21.512500000000003 28.199999999999996 28.1875 22.1 28-29 22.3875 27.700000000000003 27.2625 22.650000000000002 30-31 21.987499999999997 28.199999999999996 26.9125 22.900000000000002 32-33 21.525 28.0875 27.650000000000002 22.7375 34-35 20.974999999999998 28.15 27.525 23.35 36-37 21.5375 28.225 28.275 21.9625 38-39 22.112499999999997 29.425 26.737499999999997 21.725 40-41 22.287499999999998 27.187499999999996 28.025 22.5 42-43 21.837500000000002 28.8875 27.075 22.2 44-45 21.675 28.525 28.0875 21.712500000000002 46-47 22.400000000000002 27.737499999999997 27.462500000000002 22.400000000000002 48-49 21.4125 28.225 27.6875 22.675 50-51 22.2625 27.400000000000002 28.225 22.112499999999997 52-53 21.7875 27.987499999999997 27.250000000000004 22.975 54-55 21.25 28.375 27.474999999999998 22.900000000000002 56-57 22.6125 27.900000000000002 27.575 21.912499999999998 58-59 21.762500000000003 28.8625 27.8625 21.512500000000003 60-61 22.45 28.262500000000003 28.012500000000003 21.275 62-63 22.575 28.625 27.325 21.475 64-65 21.987499999999997 28.6625 26.775 22.575 66-67 21.6 29.1625 27.187499999999996 22.05 68-69 21.6 29.1625 27.175 22.0625 70-71 21.930482620655166 28.457114278569644 27.631907976994246 21.980495123780948 72-73 21.099999999999998 29.462500000000002 26.5875 22.85 74-75 21.925 27.875 28.287499999999998 21.912499999999998 76-77 22.225 27.525 27.750000000000004 22.5 78-79 21.970739027135174 27.5728398149306 27.635363261222956 22.821057896711267 80-81 22.237499999999997 27.3625 27.787499999999998 22.6125 82-83 21.762500000000003 27.425 28.1625 22.650000000000002 84-85 21.8 27.712500000000002 27.925 22.5625 86-87 21.9 27.737499999999997 28.175 22.1875 88-89 22.10276284535567 28.34104263032879 27.84098012251531 21.715214401800225 90-91 21.55 28.425 27.85 22.175 92-93 22.15 28.349999999999998 28.5875 20.9125 94-95 22.112499999999997 28.375 27.462500000000002 22.05 96-97 21.1125 28.6875 27.8875 22.3125 98-99 22.315289411176398 28.59107388423553 27.84098012251531 21.25265658207276 100 22.075 29.049999999999997 27.075 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 2.5 27 4.0 28 6.0 29 8.0 30 14.0 31 22.5 32 33.0 33 43.5 34 58.5 35 83.5 36 97.0 37 115.0 38 154.0 39 166.5 40 199.0 41 230.5 42 240.0 43 256.0 44 248.5 45 261.5 46 264.0 47 233.0 48 218.0 49 198.5 50 161.0 51 130.0 52 108.0 53 88.5 54 73.0 55 56.5 56 40.5 57 34.0 58 30.0 59 28.0 60 20.5 61 11.5 62 9.5 63 7.5 64 6.0 65 5.0 66 4.5 67 4.0 68 2.0 69 3.0 70 3.0 71 1.5 72 0.5 73 1.0 74 1.0 75 2.5 76 3.5 77 1.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0375 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.3012804418779814 0.6 3 0.025106703489831784 0.075 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557449 spots for SRR3207885.sra Written 1557449 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra Read 1557433 spots for SRR3207885.sra Written 1557433 spots for SRR3207885.sra SRR ids: ['SRR3207885.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_397xrdoy SRR3207885.sra spots: 31148676 blocks: [[1, 1557433], [1557434, 3114866], [3114867, 4672299], [4672300, 6229732], [6229733, 7787165], [7787166, 9344598], [9344599, 10902031], [10902032, 12459464], [12459465, 14016897], [14016898, 15574330], [15574331, 17131763], [17131764, 18689196], [18689197, 20246629], [20246630, 21804062], [21804063, 23361495], [23361496, 24918928], [24918929, 26476361], [26476362, 28033794], [28033795, 29591227], [29591228, 31148676]] SRR3207885 file size 8112142 SRR3207885 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207885 SRR3207885_1.fastq Input file: SRR3207885_1.fastq trimmed: SRR3207885-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 11:32:03 2025 >> started Tue Feb 11 11:32:20 2025 >> done (16.530s) 31148676 reads processed; of these: 7260 ( 0.02%) short reads filtered out after trimming by size control 30903 ( 0.10%) empty reads filtered out after trimming by size control 31110513 (99.88%) reads available; of these: 1825878 ( 5.87%) trimmed reads available after processing 29284635 (94.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 977 0.00% 19 1144 0.00% 20 1312 0.00% 21 1670 0.01% 22 2272 0.01% 23 3065 0.01% 24 4137 0.01% 25 5293 0.02% 26 5950 0.02% 27 5948 0.02% 28 5965 0.02% 29 6122 0.02% 30 6275 0.02% 31 6424 0.02% 32 7058 0.02% 33 7203 0.02% 34 7707 0.02% 35 7843 0.03% 36 8188 0.03% 37 8743 0.03% 38 9013 0.03% 39 8990 0.03% 40 9907 0.03% 41 10151 0.03% 42 10885 0.03% 43 11610 0.04% 44 11958 0.04% 45 12093 0.04% 46 12747 0.04% 47 12882 0.04% 48 13549 0.04% 49 13286 0.04% 50 13663 0.04% 51 13889 0.04% 52 14221 0.05% 53 14356 0.05% 54 14730 0.05% 55 14784 0.05% 56 14594 0.05% 57 14827 0.05% 58 15563 0.05% 59 15794 0.05% 60 16134 0.05% 61 16937 0.05% 62 17679 0.06% 63 17841 0.06% 64 18487 0.06% 65 18890 0.06% 66 19438 0.06% 67 20244 0.07% 68 21151 0.07% 69 19695 0.06% 70 21037 0.07% 71 22253 0.07% 72 23182 0.07% 73 24131 0.08% 74 25690 0.08% 75 26913 0.09% 76 13719 0.04% 77 15754 0.05% 78 18560 0.06% 79 20669 0.07% 80 22563 0.07% 81 23599 0.08% 82 25360 0.08% 83 27996 0.09% 84 28581 0.09% 85 30367 0.10% 86 31916 0.10% 87 35219 0.11% 88 37593 0.12% 89 40389 0.13% 90 43260 0.14% 91 46931 0.15% 92 53102 0.17% 93 57446 0.18% 94 66309 0.21% 95 73987 0.24% 96 85653 0.28% 97 97216 0.31% 98 105443 0.34% 99 107756 0.35% 100 29284635 94.13% 31110513 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=62.03 fanout-score-rank=4 prefix-density=1.17 prefix-fanout=42.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=214.12 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=24.5 sequence=AAGAAGAAGAAA Started job on | Feb 11 11:32:35 Started mapping on | Feb 11 11:32:35 Finished on | Feb 11 11:33:03 Mapping speed, Million of reads per hour | 3999.92 Number of input reads | 31110513 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 29199614 Uniquely mapped reads % | 93.86% Average mapped length | 98.24 Number of splices: Total | 8036395 Number of splices: Annotated (sjdb) | 7868930 Number of splices: GT/AG | 7901742 Number of splices: GC/AG | 109374 Number of splices: AT/AC | 9020 Number of splices: Non-canonical | 16259 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 836623 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 857451 % of reads mapped to too many loci | 2.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.68% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1074276 1074276 1074276 N_multimapping 836623 836623 836623 N_noFeature 1373108 15125450 15234298 N_ambiguous 327501 57685 57430 UnstrandedReadsAssigned:27499005 PositiveStrandReadsAssigned:14016479 NegativeStrandReadsAssigned:13907886 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207885 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207885-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,110,513 reads, 28,925,767 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR3207885.ke.tsv 34699 SRR3207885.se.tsv 87100 total ==> SRR3207885.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1502 36.7966 Potri.005G024800.1.v4.1 1035 936 2963 148.823 Potri.004G059700.1.v4.1 961 862 49 2.6724 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 751.03 12.4148 Potri.016G087400.1.v4.1 270 171 1100 302.419 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 222 6.23463 Potri.012G127500.1.v4.1 977 878 5707 305.581 ==> SRR3207885.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2505 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 637 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 90 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 23 SRR3207885 completed mapping pipeline successfully