Starting /dee2/code/volunteer_pipeline.sh SRR3207886 current disk space = 3051262615552 free memory = 1488615896 SRR3207886 SRAfilesize e8dd29c217719838d5a716a0a7fafa54 SRR3207886.sra SRR3207886.sra file validated SRR3207886 is single end SRR3207886 is conventional basespace SRR3207886 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207886_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1905 34.0 34.0 34.0 31.0 34.0 2 33.383 34.0 34.0 34.0 31.0 34.0 3 33.5165 34.0 34.0 34.0 31.0 34.0 4 36.739 37.0 37.0 37.0 37.0 37.0 5 36.652 37.0 37.0 37.0 35.0 37.0 6 36.69775 37.0 37.0 37.0 36.0 37.0 7 36.674 37.0 37.0 37.0 36.0 37.0 8 36.69025 37.0 37.0 37.0 36.0 37.0 9 38.6245 39.0 39.0 39.0 38.0 39.0 10-11 38.627624999999995 39.0 39.0 39.0 38.0 39.0 12-13 38.619749999999996 39.0 39.0 39.0 38.0 39.0 14-15 40.334500000000006 41.0 41.0 41.0 39.0 41.0 16-17 40.31925 41.0 41.0 41.0 39.0 41.0 18-19 40.259125 41.0 40.0 41.0 39.0 41.0 20-21 40.285875000000004 41.0 40.5 41.0 39.0 41.0 22-23 40.204750000000004 41.0 40.0 41.0 39.0 41.0 24-25 40.18025 41.0 40.0 41.0 39.0 41.0 26-27 40.11125 41.0 40.0 41.0 38.5 41.0 28-29 39.973375000000004 41.0 40.0 41.0 38.0 41.0 30-31 40.0075 41.0 40.0 41.0 38.0 41.0 32-33 39.929500000000004 41.0 40.0 41.0 38.0 41.0 34-35 39.876999999999995 41.0 40.0 41.0 38.0 41.0 36-37 39.726749999999996 41.0 40.0 41.0 38.0 41.0 38-39 39.66175 41.0 40.0 41.0 38.0 41.0 40-41 39.5985 41.0 40.0 41.0 37.0 41.0 42-43 39.5205 41.0 40.0 41.0 37.0 41.0 44-45 39.48625 41.0 40.0 41.0 37.0 41.0 46-47 39.375875 41.0 40.0 41.0 36.5 41.0 48-49 39.392125 41.0 40.0 41.0 37.0 41.0 50-51 39.280375 41.0 39.0 41.0 36.0 41.0 52-53 39.127875 41.0 39.0 41.0 36.0 41.0 54-55 39.02575 41.0 39.0 41.0 35.5 41.0 56-57 39.05675 41.0 39.0 41.0 35.0 41.0 58-59 38.996125000000006 41.0 39.0 41.0 35.0 41.0 60-61 38.852625 41.0 38.5 41.0 35.0 41.0 62-63 38.61925 40.0 37.5 41.0 35.0 41.0 64-65 38.302375 40.0 37.0 41.0 35.0 41.0 66-67 37.890375 39.0 36.5 41.0 35.0 41.0 68-69 37.387125 39.0 36.0 41.0 34.0 41.0 70-71 37.093999999999994 38.0 35.0 40.5 34.0 41.0 72-73 36.622125 37.0 35.0 39.0 34.0 41.0 74-75 36.231125 37.0 35.0 39.0 34.0 41.0 76-77 34.64725 35.0 33.5 37.0 31.0 39.0 78-79 35.312375 36.0 35.0 37.0 33.0 39.0 80-81 35.182 35.0 35.0 37.0 34.0 39.0 82-83 34.894125 35.0 35.0 36.5 34.0 37.0 84-85 34.621875 35.0 35.0 36.0 34.0 37.0 86-87 34.405625 35.0 35.0 36.0 33.5 36.5 88-89 34.191874999999996 35.0 35.0 35.5 33.0 36.0 90-91 34.1385 35.0 35.0 35.0 33.0 36.0 92-93 33.88825 35.0 35.0 35.0 33.0 36.0 94-95 33.751875 35.0 35.0 35.0 32.5 36.0 96-97 33.635999999999996 35.0 35.0 35.0 32.5 36.0 98-99 33.58475 35.0 35.0 35.0 32.5 35.5 100 33.50875 35.0 35.0 35.0 33.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 4.0 14 0.0 15 1.0 16 6.0 17 1.0 18 4.0 19 5.0 20 2.0 21 7.0 22 4.0 23 6.0 24 6.0 25 8.0 26 11.0 27 7.0 28 12.0 29 14.0 30 27.0 31 22.0 32 30.0 33 38.0 34 54.0 35 102.0 36 231.0 37 788.0 38 1963.0 39 642.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.698540513336688 15.072974333165575 17.262204328132864 40.96628082536487 2 20.599999999999998 22.400000000000002 36.0 21.0 3 23.1 25.650000000000002 27.025 24.224999999999998 4 24.0 32.85 20.8 22.35 5 24.45 35.375 22.425 17.75 6 18.325 37.6 24.45 19.625 7 17.1 17.925 45.775 19.2 8 18.575 23.35 29.95 28.125 9 20.5 22.725 31.45 25.324999999999996 10-11 23.1125 33.387499999999996 21.8625 21.637500000000003 12-13 20.0375 26.875 30.275000000000002 22.8125 14-15 21.4125 26.674999999999997 29.225 22.6875 16-17 22.325 28.575 26.950000000000003 22.15 18-19 21.325 29.375 26.75 22.55 20-21 21.5375 27.950000000000003 28.3625 22.15 22-23 21.2375 28.1625 28.525 22.075 24-25 22.125 27.762500000000003 27.737499999999997 22.375 26-27 21.5625 27.987499999999997 27.500000000000004 22.95 28-29 21.55 27.575 28.5625 22.3125 30-31 21.85 27.9375 28.375 21.837500000000002 32-33 21.3875 28.6125 28.1375 21.8625 34-35 22.25 27.725 28.1375 21.8875 36-37 21.3875 29.049999999999997 27.575 21.987499999999997 38-39 20.8625 29.5875 26.6625 22.8875 40-41 21.375 28.299999999999997 27.6875 22.6375 42-43 21.8625 29.9875 26.2125 21.9375 44-45 21.475 28.875 28.262500000000003 21.3875 46-47 21.712500000000002 27.712500000000002 27.85 22.725 48-49 20.95 28.625 27.900000000000002 22.525000000000002 50-51 22.425 28.95 27.0125 21.6125 52-53 21.725 28.812500000000004 27.150000000000002 22.3125 54-55 22.25 28.199999999999996 28.125 21.425 56-57 21.075 28.875 28.025 22.025 58-59 22.275 27.787499999999998 27.212500000000002 22.725 60-61 21.587500000000002 27.6 28.325 22.4875 62-63 21.125 28.299999999999997 28.3375 22.237499999999997 64-65 21.762500000000003 27.8125 27.775 22.650000000000002 66-67 21.8875 28.525 27.5625 22.025 68-69 22.375 27.825 27.825 21.975 70-71 21.065133141642704 29.278659832479057 28.128516064508062 21.527690961370173 72-73 22.237499999999997 27.500000000000004 28.5875 21.675 74-75 21.7375 28.6375 27.787499999999998 21.837500000000002 76-77 23.3625 28.762500000000003 27.0625 20.8125 78-79 21.637500000000003 28.512500000000003 27.675 22.175 80-81 21.85 28.000000000000004 27.925 22.225 82-83 22.375 28.000000000000004 27.6375 21.987499999999997 84-85 23.025000000000002 27.85 26.987499999999997 22.1375 86-87 21.875 28.499999999999996 27.925 21.7 88-89 21.4 27.450000000000003 28.125 23.025000000000002 90-91 21.725 28.1125 28.1375 22.025 92-93 22.125 28.0875 28.825 20.962500000000002 94-95 22.2 28.299999999999997 27.750000000000004 21.75 96-97 21.7 28.6125 28.1125 21.575 98-99 21.637500000000003 28.025 28.425 21.912499999999998 100 23.425 28.475 27.250000000000004 20.849999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 3.5 25 6.0 26 5.0 27 4.0 28 10.5 29 12.5 30 17.0 31 30.0 32 35.5 33 46.0 34 67.5 35 84.5 36 97.0 37 115.0 38 132.5 39 163.5 40 195.0 41 220.0 42 259.0 43 264.5 44 271.5 45 279.0 46 242.5 47 215.0 48 210.5 49 195.0 50 163.0 51 130.0 52 106.5 53 96.0 54 76.5 55 48.5 56 34.0 57 35.5 58 29.0 59 16.0 60 11.0 61 11.0 62 9.5 63 7.5 64 8.5 65 7.0 66 2.0 67 0.0 68 1.0 69 3.5 70 2.5 71 1.5 72 3.0 73 2.5 74 2.0 75 1.5 76 2.0 77 2.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754686 spots for SRR3207886.sra Written 754686 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra Read 754676 spots for SRR3207886.sra Written 754676 spots for SRR3207886.sra SRR ids: ['SRR3207886.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2w10hclr SRR3207886.sra spots: 15093530 blocks: [[1, 754676], [754677, 1509352], [1509353, 2264028], [2264029, 3018704], [3018705, 3773380], [3773381, 4528056], [4528057, 5282732], [5282733, 6037408], [6037409, 6792084], [6792085, 7546760], [7546761, 8301436], [8301437, 9056112], [9056113, 9810788], [9810789, 10565464], [10565465, 11320140], [11320141, 12074816], [12074817, 12829492], [12829493, 13584168], [13584169, 14338844], [14338845, 15093530]] SRR3207886 file size 3925275 SRR3207886 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207886 SRR3207886_1.fastq Input file: SRR3207886_1.fastq trimmed: SRR3207886-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:03:31 2025 >> started Tue Feb 11 12:03:38 2025 >> done (6.692s) 15093530 reads processed; of these: 3069 ( 0.02%) short reads filtered out after trimming by size control 12726 ( 0.08%) empty reads filtered out after trimming by size control 15077735 (99.90%) reads available; of these: 786705 ( 5.22%) trimmed reads available after processing 14291030 (94.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 354 0.00% 19 468 0.00% 20 543 0.00% 21 782 0.01% 22 1007 0.01% 23 1361 0.01% 24 1752 0.01% 25 2281 0.02% 26 2454 0.02% 27 2523 0.02% 28 2517 0.02% 29 2682 0.02% 30 2640 0.02% 31 2743 0.02% 32 2895 0.02% 33 3032 0.02% 34 3206 0.02% 35 3442 0.02% 36 3451 0.02% 37 3632 0.02% 38 3922 0.03% 39 3816 0.03% 40 4166 0.03% 41 4146 0.03% 42 4465 0.03% 43 4769 0.03% 44 4769 0.03% 45 4995 0.03% 46 5290 0.04% 47 5280 0.04% 48 5508 0.04% 49 5319 0.04% 50 5543 0.04% 51 5639 0.04% 52 5638 0.04% 53 5828 0.04% 54 5875 0.04% 55 5680 0.04% 56 5811 0.04% 57 6053 0.04% 58 6235 0.04% 59 6332 0.04% 60 6419 0.04% 61 6698 0.04% 62 6891 0.05% 63 7075 0.05% 64 7299 0.05% 65 7656 0.05% 66 7691 0.05% 67 8024 0.05% 68 8372 0.06% 69 7994 0.05% 70 8562 0.06% 71 8941 0.06% 72 9297 0.06% 73 9641 0.06% 74 10181 0.07% 75 10850 0.07% 76 5531 0.04% 77 6424 0.04% 78 7777 0.05% 79 8665 0.06% 80 9487 0.06% 81 9701 0.06% 82 10314 0.07% 83 11346 0.08% 84 11828 0.08% 85 12696 0.08% 86 13595 0.09% 87 14964 0.10% 88 16170 0.11% 89 17427 0.12% 90 19206 0.13% 91 20737 0.14% 92 23625 0.16% 93 26045 0.17% 94 29851 0.20% 95 34240 0.23% 96 39656 0.26% 97 45291 0.30% 98 49703 0.33% 99 51991 0.34% 100 14291030 94.78% 15077735 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=64.17 fanout-score-rank=3 prefix-density=0.81 prefix-fanout=42.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=135.35 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=13.8 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGG Started job on | Feb 11 12:03:55 Started mapping on | Feb 11 12:03:56 Finished on | Feb 11 12:04:12 Mapping speed, Million of reads per hour | 3392.49 Number of input reads | 15077735 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 14249011 Uniquely mapped reads % | 94.50% Average mapped length | 98.51 Number of splices: Total | 3879377 Number of splices: Annotated (sjdb) | 3800517 Number of splices: GT/AG | 3815877 Number of splices: GC/AG | 51624 Number of splices: AT/AC | 4502 Number of splices: Non-canonical | 7374 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388662 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 340027 % of reads mapped to too many loci | 2.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 440062 440062 440062 N_multimapping 388662 388662 388662 N_noFeature 655689 7347050 7442928 N_ambiguous 168857 27383 27017 UnstrandedReadsAssigned:13424465 PositiveStrandReadsAssigned:6874578 NegativeStrandReadsAssigned:6779066 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207886 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207886-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,077,735 reads, 14,039,321 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR3207886.ke.tsv 34699 SRR3207886.se.tsv 87100 total ==> SRR3207886.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 789 38.7388 Potri.005G024800.1.v4.1 1035 936 2221 223.572 Potri.004G059700.1.v4.1 961 862 32 3.49774 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 305.196 10.111 Potri.016G087400.1.v4.1 270 171 526 289.824 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 156 8.78039 Potri.012G127500.1.v4.1 977 878 2108 226.215 ==> SRR3207886.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1342 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 337 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 59 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR3207886 completed mapping pipeline successfully