Starting /dee2/code/volunteer_pipeline.sh SRR3207887 current disk space = 3051119185920 free memory = 1516114112 SRR3207887 SRAfilesize dc212cb92194c01522ee4040dd8790a2 SRR3207887.sra SRR3207887.sra file validated SRR3207887 is single end SRR3207887 is conventional basespace SRR3207887 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207887_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.034 34.0 33.0 34.0 31.0 34.0 2 33.27925 34.0 34.0 34.0 31.0 34.0 3 33.44575 34.0 34.0 34.0 31.0 34.0 4 36.69025 37.0 37.0 37.0 37.0 37.0 5 36.63925 37.0 37.0 37.0 35.0 37.0 6 36.6625 37.0 37.0 37.0 36.0 37.0 7 36.65425 37.0 37.0 37.0 35.0 37.0 8 36.672 37.0 37.0 37.0 36.0 37.0 9 38.6355 39.0 39.0 39.0 38.0 39.0 10-11 38.625125 39.0 39.0 39.0 38.0 39.0 12-13 38.586625 39.0 39.0 39.0 38.0 39.0 14-15 40.317499999999995 41.0 41.0 41.0 39.0 41.0 16-17 40.2765 41.0 40.0 41.0 39.0 41.0 18-19 40.2465 41.0 40.0 41.0 39.0 41.0 20-21 40.265 41.0 40.0 41.0 39.0 41.0 22-23 40.19625 41.0 40.0 41.0 39.0 41.0 24-25 40.168625 41.0 40.0 41.0 39.0 41.0 26-27 40.05875 41.0 40.0 41.0 38.0 41.0 28-29 39.90075 41.0 40.0 41.0 38.0 41.0 30-31 39.903999999999996 41.0 40.0 41.0 38.0 41.0 32-33 39.839749999999995 41.0 40.0 41.0 38.0 41.0 34-35 39.811875 41.0 40.0 41.0 38.0 41.0 36-37 39.623374999999996 41.0 40.0 41.0 37.5 41.0 38-39 39.523125 41.0 40.0 41.0 37.0 41.0 40-41 39.490625 41.0 40.0 41.0 37.0 41.0 42-43 39.35825 41.0 39.5 41.0 36.0 41.0 44-45 39.266125 41.0 39.0 41.0 36.0 41.0 46-47 39.160624999999996 41.0 39.0 41.0 35.5 41.0 48-49 39.218625 41.0 39.0 41.0 35.5 41.0 50-51 39.062625 41.0 39.0 41.0 35.0 41.0 52-53 38.907125 40.5 39.0 41.0 35.0 41.0 54-55 38.756249999999994 40.5 38.5 41.0 35.0 41.0 56-57 38.802625 41.0 39.0 41.0 35.0 41.0 58-59 38.78425 41.0 38.5 41.0 35.0 41.0 60-61 38.570750000000004 40.5 37.5 41.0 35.0 41.0 62-63 38.319874999999996 40.0 37.0 41.0 35.0 41.0 64-65 37.983875 39.0 36.5 41.0 35.0 41.0 66-67 37.596125 39.0 36.0 41.0 34.5 41.0 68-69 37.09325 38.5 35.0 41.0 34.0 41.0 70-71 36.789500000000004 37.0 35.0 39.5 34.0 41.0 72-73 36.271375000000006 37.0 35.0 39.0 33.5 41.0 74-75 35.879625 36.5 35.0 39.0 33.5 40.5 76-77 34.267625 35.0 33.5 36.5 30.0 39.0 78-79 34.956125 35.0 35.0 37.0 32.5 39.0 80-81 34.7935 35.0 35.0 37.0 33.0 38.5 82-83 34.567750000000004 35.0 35.0 36.0 33.0 37.0 84-85 34.335750000000004 35.0 35.0 36.0 33.0 37.0 86-87 34.083 35.0 35.0 36.0 33.0 36.5 88-89 33.913250000000005 35.0 35.0 35.0 32.5 36.0 90-91 33.818875 35.0 35.0 35.0 32.5 36.0 92-93 33.638625000000005 35.0 35.0 35.0 32.0 36.0 94-95 33.463875 35.0 35.0 35.0 32.0 36.0 96-97 33.30675 35.0 35.0 35.0 31.0 35.0 98-99 33.34975 35.0 35.0 35.0 31.5 35.0 100 33.2405 35.0 35.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 2.0 6 0.0 7 0.0 8 2.0 9 1.0 10 0.0 11 4.0 12 1.0 13 4.0 14 1.0 15 1.0 16 1.0 17 3.0 18 4.0 19 6.0 20 4.0 21 4.0 22 7.0 23 4.0 24 4.0 25 6.0 26 8.0 27 10.0 28 19.0 29 14.0 30 14.0 31 34.0 32 40.0 33 67.0 34 88.0 35 125.0 36 291.0 37 801.0 38 1873.0 39 556.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.954005559767502 14.000505433409149 17.487995956532725 42.557493050290624 2 21.45 22.25 35.325 20.974999999999998 3 23.05 25.85 27.075 24.025 4 24.15 32.1 20.4 23.35 5 26.125 34.975 20.075000000000003 18.825 6 19.5 37.025000000000006 23.025000000000002 20.45 7 16.45 18.35 44.3 20.9 8 19.950000000000003 22.575 30.65 26.825 9 20.599999999999998 23.3 31.075000000000003 25.025 10-11 23.150000000000002 32.675 22.237499999999997 21.9375 12-13 20.9 26.724999999999998 29.75 22.625 14-15 21.912499999999998 27.8375 28.15 22.1 16-17 21.712500000000002 28.000000000000004 27.450000000000003 22.8375 18-19 22.2 28.287499999999998 27.325 22.1875 20-21 22.15 28.075 26.487500000000004 23.2875 22-23 21.725 28.1375 26.924999999999997 23.2125 24-25 22.237499999999997 28.499999999999996 26.025 23.2375 26-27 21.4875 28.349999999999998 27.3625 22.8 28-29 22.0 28.050000000000004 27.787499999999998 22.162499999999998 30-31 22.1875 27.675 26.8125 23.325000000000003 32-33 21.587500000000002 27.700000000000003 27.5125 23.200000000000003 34-35 22.4375 28.3875 26.787499999999998 22.3875 36-37 22.95 26.7625 27.787499999999998 22.5 38-39 21.7375 28.000000000000004 27.900000000000002 22.3625 40-41 22.787499999999998 28.000000000000004 27.1 22.112499999999997 42-43 22.8875 28.575 26.450000000000003 22.0875 44-45 22.7125 26.900000000000002 27.3375 23.05 46-47 22.5875 27.487499999999997 27.3375 22.5875 48-49 21.55 28.1375 27.825 22.4875 50-51 22.162499999999998 27.6875 28.249999999999996 21.9 52-53 23.0 27.3875 27.075 22.537499999999998 54-55 22.45 27.3125 26.950000000000003 23.2875 56-57 22.225 27.55 28.037499999999998 22.1875 58-59 22.787499999999998 26.950000000000003 27.625 22.6375 60-61 23.2125 26.85 27.05 22.8875 62-63 23.2375 27.8625 26.900000000000002 22.0 64-65 23.1 27.675 26.875 22.35 66-67 21.6625 27.3375 27.500000000000004 23.5 68-69 22.45 27.05 28.199999999999996 22.3 70-71 22.3 27.8125 26.75 23.1375 72-73 21.575 27.0875 28.95 22.3875 74-75 21.8875 27.712500000000002 27.250000000000004 23.150000000000002 76-77 23.425 27.474999999999998 27.0 22.1 78-79 22.537499999999998 27.575 27.3375 22.55 80-81 22.5125 28.375 26.950000000000003 22.162499999999998 82-83 22.7125 26.900000000000002 27.8625 22.525000000000002 84-85 22.4625 28.0625 27.0 22.475 86-87 23.0625 27.700000000000003 27.3125 21.925 88-89 23.3 27.737499999999997 26.7125 22.25 90-91 21.875 28.762500000000003 27.212500000000002 22.15 92-93 22.3875 27.762500000000003 26.887499999999996 22.9625 94-95 22.662499999999998 28.812500000000004 26.787499999999998 21.7375 96-97 22.1875 28.349999999999998 27.400000000000002 22.0625 98-99 23.0875 27.525 26.7125 22.675 100 23.3 28.65 25.900000000000002 22.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 1.0 25 1.0 26 1.0 27 3.5 28 6.5 29 12.5 30 22.0 31 23.5 32 23.0 33 31.5 34 45.0 35 69.0 36 90.5 37 105.5 38 131.0 39 155.5 40 192.0 41 224.0 42 236.5 43 250.0 44 254.5 45 253.0 46 250.5 47 232.0 48 210.5 49 185.0 50 155.5 51 150.5 52 122.0 53 82.0 54 71.0 55 66.5 56 55.0 57 42.0 58 35.5 59 30.5 60 25.0 61 21.0 62 21.0 63 14.0 64 11.0 65 12.0 66 5.5 67 6.0 68 9.5 69 9.0 70 7.0 71 6.5 72 7.5 73 6.0 74 3.0 75 2.5 76 3.5 77 3.0 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47129909365559 98.775 2 0.4531722054380665 0.8999999999999999 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025176233635448138 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6499999999999999 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88 1.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra Read 1109306 spots for SRR3207887.sra Written 1109306 spots for SRR3207887.sra Read 1109302 spots for SRR3207887.sra Written 1109302 spots for SRR3207887.sra SRR ids: ['SRR3207887.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l0l2yxlk SRR3207887.sra spots: 22186044 blocks: [[1, 1109302], [1109303, 2218604], [2218605, 3327906], [3327907, 4437208], [4437209, 5546510], [5546511, 6655812], [6655813, 7765114], [7765115, 8874416], [8874417, 9983718], [9983719, 11093020], [11093021, 12202322], [12202323, 13311624], [13311625, 14420926], [14420927, 15530228], [15530229, 16639530], [16639531, 17748832], [17748833, 18858134], [18858135, 19967436], [19967437, 21076738], [21076739, 22186044]] SRR3207887 file size 5774858 SRR3207887 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207887 SRR3207887_1.fastq Input file: SRR3207887_1.fastq trimmed: SRR3207887-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:07:29 2025 >> started Tue Feb 11 12:07:41 2025 >> done (11.505s) 22186044 reads processed; of these: 5358 ( 0.02%) short reads filtered out after trimming by size control 30567 ( 0.14%) empty reads filtered out after trimming by size control 22150119 (99.84%) reads available; of these: 1263278 ( 5.70%) trimmed reads available after processing 20886841 (94.30%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 742 0.00% 19 823 0.00% 20 1019 0.00% 21 1229 0.01% 22 1678 0.01% 23 2208 0.01% 24 3037 0.01% 25 3780 0.02% 26 4228 0.02% 27 4267 0.02% 28 4267 0.02% 29 4329 0.02% 30 4611 0.02% 31 4666 0.02% 32 5110 0.02% 33 4942 0.02% 34 5505 0.02% 35 5407 0.02% 36 5816 0.03% 37 6042 0.03% 38 6555 0.03% 39 6289 0.03% 40 7008 0.03% 41 7144 0.03% 42 7682 0.03% 43 8004 0.04% 44 8195 0.04% 45 7942 0.04% 46 8352 0.04% 47 8471 0.04% 48 8650 0.04% 49 8711 0.04% 50 8909 0.04% 51 8975 0.04% 52 9012 0.04% 53 9198 0.04% 54 9370 0.04% 55 9134 0.04% 56 9292 0.04% 57 9522 0.04% 58 10214 0.05% 59 10162 0.05% 60 10819 0.05% 61 11184 0.05% 62 11870 0.05% 63 11938 0.05% 64 12263 0.06% 65 12993 0.06% 66 13231 0.06% 67 14029 0.06% 68 14541 0.07% 69 12468 0.06% 70 13747 0.06% 71 14377 0.06% 72 14849 0.07% 73 15842 0.07% 74 16371 0.07% 75 17884 0.08% 76 8442 0.04% 77 9934 0.04% 78 12463 0.06% 79 13451 0.06% 80 14868 0.07% 81 15587 0.07% 82 17058 0.08% 83 18170 0.08% 84 19031 0.09% 85 20735 0.09% 86 21668 0.10% 87 23838 0.11% 88 25971 0.12% 89 28022 0.13% 90 30121 0.14% 91 33008 0.15% 92 38015 0.17% 93 40674 0.18% 94 47657 0.22% 95 53992 0.24% 96 62353 0.28% 97 71927 0.32% 98 77867 0.35% 99 79523 0.36% 100 20886841 94.30% 22150119 reads passed initial QC criterion=sequence-density sequence-density=1.20 sequence-density-rank=1 fanout-score=64.09 fanout-score-rank=1 prefix-density=1.72 prefix-fanout=44.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=1.20 sequence-density-rank=1 fanout-score=64.09 fanout-score-rank=1 prefix-density=1.72 prefix-fanout=44.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA Started job on | Feb 11 12:07:58 Started mapping on | Feb 11 12:07:59 Finished on | Feb 11 12:08:26 Mapping speed, Million of reads per hour | 2953.35 Number of input reads | 22150119 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19280431 Uniquely mapped reads % | 87.04% Average mapped length | 98.29 Number of splices: Total | 5565855 Number of splices: Annotated (sjdb) | 5446536 Number of splices: GT/AG | 5466642 Number of splices: GC/AG | 80158 Number of splices: AT/AC | 7099 Number of splices: Non-canonical | 11956 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 670418 % of reads mapped to multiple loci | 3.03% Number of reads mapped to too many loci | 2035228 % of reads mapped to too many loci | 9.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2199270 2199270 2199270 N_multimapping 670418 670418 670418 N_noFeature 854437 9969198 10055834 N_ambiguous 187767 39273 39051 UnstrandedReadsAssigned:18238227 PositiveStrandReadsAssigned:9271960 NegativeStrandReadsAssigned:9185546 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207887 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207887-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,150,119 reads, 20,580,446 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52401 SRR3207887.ke.tsv 34699 SRR3207887.se.tsv 87100 total ==> SRR3207887.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1740 58.8387 Potri.005G024800.1.v4.1 1035 936 2280 158.069 Potri.004G059700.1.v4.1 961 862 16 1.20449 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 695.583 15.8712 Potri.016G087400.1.v4.1 270 171 562 213.27 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 157.82 6.11779 Potri.012G127500.1.v4.1 977 878 4117 304.281 ==> SRR3207887.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 723 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 23 SRR3207887 completed mapping pipeline successfully