Starting /dee2/code/volunteer_pipeline.sh SRR3207888 current disk space = 3051241316352 free memory = 1199707832 SRR3207888 SRAfilesize 54bb767f0306efdce370c6e5ea1bb3b8 SRR3207888.sra SRR3207888.sra file validated SRR3207888 is single end SRR3207888 is conventional basespace SRR3207888 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207888_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0185 34.0 34.0 34.0 31.0 34.0 2 33.26075 34.0 34.0 34.0 31.0 34.0 3 33.421 34.0 34.0 34.0 31.0 34.0 4 36.65825 37.0 37.0 37.0 35.0 37.0 5 36.597 37.0 37.0 37.0 35.0 37.0 6 36.66325 37.0 37.0 37.0 35.0 37.0 7 36.61575 37.0 37.0 37.0 35.0 37.0 8 36.67125 37.0 37.0 37.0 35.0 37.0 9 38.603 39.0 39.0 39.0 38.0 39.0 10-11 38.605125 39.0 39.0 39.0 38.0 39.0 12-13 38.548249999999996 39.0 39.0 39.0 38.0 39.0 14-15 40.274875 41.0 40.0 41.0 39.0 41.0 16-17 40.220625 41.0 40.0 41.0 39.0 41.0 18-19 40.212625 41.0 40.0 41.0 39.0 41.0 20-21 40.158375 41.0 40.0 41.0 39.0 41.0 22-23 40.081374999999994 41.0 40.0 41.0 38.5 41.0 24-25 40.04675 41.0 40.0 41.0 38.0 41.0 26-27 39.917875 41.0 40.0 41.0 38.0 41.0 28-29 39.764 41.0 40.0 41.0 38.0 41.0 30-31 39.794 41.0 40.0 41.0 38.0 41.0 32-33 39.691625 41.0 40.0 41.0 38.0 41.0 34-35 39.584 41.0 40.0 41.0 37.0 41.0 36-37 39.358 41.0 40.0 41.0 36.5 41.0 38-39 39.244875 41.0 39.5 41.0 36.0 41.0 40-41 39.22625 41.0 39.0 41.0 36.0 41.0 42-43 39.052625 41.0 39.0 41.0 35.0 41.0 44-45 38.8705 41.0 39.0 41.0 35.0 41.0 46-47 38.882125 41.0 39.0 41.0 35.0 41.0 48-49 38.872375000000005 41.0 39.0 41.0 35.0 41.0 50-51 38.698125 41.0 39.0 41.0 35.0 41.0 52-53 38.48950000000001 40.0 38.0 41.0 35.0 41.0 54-55 38.387125 40.0 38.0 41.0 34.5 41.0 56-57 38.491375 40.0 38.0 41.0 35.0 41.0 58-59 38.42825 40.5 37.5 41.0 35.0 41.0 60-61 38.178 40.0 37.0 41.0 35.0 41.0 62-63 37.932125 40.0 36.5 41.0 34.5 41.0 64-65 37.605000000000004 39.0 36.0 41.0 34.0 41.0 66-67 37.257 39.0 35.5 41.0 34.0 41.0 68-69 36.754000000000005 38.0 35.0 40.5 33.0 41.0 70-71 36.478 37.0 35.0 39.5 33.0 41.0 72-73 35.932375 37.0 35.0 39.0 33.0 41.0 74-75 35.64275 36.0 35.0 39.0 33.0 40.5 76-77 33.93925 35.0 33.5 36.5 30.0 39.0 78-79 34.673375 35.0 35.0 37.0 32.0 39.0 80-81 34.559 35.0 35.0 37.0 33.0 38.0 82-83 34.36475 35.0 35.0 36.0 33.0 37.0 84-85 34.07899999999999 35.0 35.0 36.0 33.0 37.0 86-87 33.82599999999999 35.0 35.0 35.5 32.5 36.5 88-89 33.623374999999996 35.0 35.0 35.0 32.0 36.0 90-91 33.543875 35.0 35.0 35.0 32.0 36.0 92-93 33.319 35.0 34.5 35.0 31.5 36.0 94-95 33.1935 35.0 34.5 35.0 31.0 35.5 96-97 33.084 35.0 34.0 35.0 31.0 35.0 98-99 33.033 35.0 34.0 35.0 31.0 35.0 100 32.8755 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 3.0 9 3.0 10 3.0 11 3.0 12 2.0 13 3.0 14 4.0 15 3.0 16 3.0 17 4.0 18 4.0 19 7.0 20 3.0 21 9.0 22 6.0 23 7.0 24 13.0 25 9.0 26 8.0 27 12.0 28 21.0 29 22.0 30 16.0 31 28.0 32 41.0 33 68.0 34 106.0 35 138.0 36 311.0 37 800.0 38 1812.0 39 525.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.224469160768454 13.928210313447927 16.78463094034378 42.06268958543984 2 21.575 22.05 34.725 21.65 3 23.625 25.674999999999997 26.900000000000002 23.799999999999997 4 25.575 30.15 20.0 24.275 5 25.056264066016503 34.15853963490873 21.930482620655166 18.854713678419603 6 19.925 37.075 22.650000000000002 20.349999999999998 7 16.7 18.35 43.425000000000004 21.525 8 20.275000000000002 23.200000000000003 27.950000000000003 28.575 9 20.599999999999998 23.275000000000002 30.575000000000003 25.55 10-11 23.25 32.525 21.275 22.95 12-13 20.6625 26.05 29.45 23.8375 14-15 22.175 26.650000000000002 27.875 23.3 16-17 22.3875 27.750000000000004 26.5125 23.35 18-19 22.412499999999998 27.8125 26.150000000000002 23.625 20-21 22.45 28.349999999999998 26.775 22.425 22-23 23.1375 27.825 26.787499999999998 22.25 24-25 22.25 27.950000000000003 27.075 22.725 26-27 22.6125 27.3875 27.287499999999998 22.7125 28-29 22.5625 27.650000000000002 27.2625 22.525000000000002 30-31 21.6 27.224999999999998 27.2625 23.9125 32-33 22.775000000000002 27.762500000000003 26.4125 23.05 34-35 21.9 28.1375 26.55 23.4125 36-37 22.625 26.825 27.3125 23.2375 38-39 23.425 28.262500000000003 25.05 23.2625 40-41 22.8125 28.525 26.375 22.287499999999998 42-43 23.275000000000002 27.35 26.775 22.6 44-45 22.9875 27.0 26.35 23.6625 46-47 22.2 28.012500000000003 26.3125 23.474999999999998 48-49 22.5125 27.487499999999997 26.9625 23.0375 50-51 22.8 28.762500000000003 26.55 21.8875 52-53 22.8 27.1125 27.400000000000002 22.6875 54-55 23.1375 27.787499999999998 26.8375 22.237499999999997 56-57 21.825 27.9375 27.05 23.1875 58-59 21.9375 28.1375 27.175 22.75 60-61 23.4875 26.125 26.625 23.7625 62-63 23.1375 27.125 27.8125 21.925 64-65 22.15 27.6875 27.200000000000003 22.9625 66-67 22.7625 26.8375 27.3 23.1 68-69 23.400000000000002 27.3125 26.8375 22.45 70-71 23.1375 28.4375 25.8 22.625 72-73 22.45 28.212500000000002 26.525 22.8125 74-75 22.112499999999997 27.437499999999996 27.1625 23.2875 76-77 23.150000000000002 26.6 27.725 22.525000000000002 78-79 22.7625 26.987499999999997 27.8125 22.4375 80-81 22.4625 26.8 26.625 24.1125 82-83 22.9875 27.4125 26.424999999999997 23.175 84-85 23.8875 27.250000000000004 26.187500000000004 22.675 86-87 23.225 28.075 26.55 22.15 88-89 23.6875 26.775 26.8 22.7375 90-91 23.3375 28.475 26.6125 21.575 92-93 22.575 28.037499999999998 26.8625 22.525000000000002 94-95 23.25 28.6625 26.2625 21.825 96-97 23.525 27.3375 26.2125 22.925 98-99 23.375 28.075 25.650000000000002 22.900000000000002 100 22.75 28.775000000000002 25.874999999999996 22.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.0 24 1.0 25 1.5 26 2.0 27 2.5 28 6.5 29 9.5 30 10.0 31 16.5 32 22.5 33 33.0 34 51.0 35 71.0 36 87.5 37 96.5 38 113.5 39 139.5 40 169.0 41 196.0 42 230.5 43 245.5 44 248.0 45 257.0 46 245.0 47 242.5 48 229.0 49 184.5 50 152.0 51 142.0 52 132.0 53 102.0 54 81.5 55 64.0 56 47.5 57 41.0 58 36.0 59 38.5 60 31.5 61 25.5 62 25.5 63 22.0 64 16.0 65 13.0 66 12.0 67 15.0 68 15.0 69 8.0 70 7.0 71 7.5 72 9.0 73 9.0 74 6.5 75 5.5 76 6.0 77 5.5 78 3.0 79 1.0 80 0.5 81 1.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65482233502539 97.175 2 1.1928934010152283 2.35 3 0.12690355329949238 0.375 4 0.025380710659898477 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261473 spots for SRR3207888.sra Written 1261473 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra Read 1261467 spots for SRR3207888.sra Written 1261467 spots for SRR3207888.sra SRR ids: ['SRR3207888.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vsb30j_2 SRR3207888.sra spots: 25229346 blocks: [[1, 1261467], [1261468, 2522934], [2522935, 3784401], [3784402, 5045868], [5045869, 6307335], [6307336, 7568802], [7568803, 8830269], [8830270, 10091736], [10091737, 11353203], [11353204, 12614670], [12614671, 13876137], [13876138, 15137604], [15137605, 16399071], [16399072, 17660538], [17660539, 18922005], [18922006, 20183472], [20183473, 21444939], [21444940, 22706406], [22706407, 23967873], [23967874, 25229346]] SRR3207888 file size 6568488 SRR3207888 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207888 SRR3207888_1.fastq Input file: SRR3207888_1.fastq trimmed: SRR3207888-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:00:43 2025 >> started Tue Feb 11 12:01:01 2025 >> done (17.509s) 25229346 reads processed; of these: 4481 ( 0.02%) short reads filtered out after trimming by size control 24537 ( 0.10%) empty reads filtered out after trimming by size control 25200328 (99.88%) reads available; of these: 1613011 ( 6.40%) trimmed reads available after processing 23587317 (93.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 676 0.00% 19 882 0.00% 20 1177 0.00% 21 1414 0.01% 22 2057 0.01% 23 2771 0.01% 24 3633 0.01% 25 4871 0.02% 26 5376 0.02% 27 5401 0.02% 28 5326 0.02% 29 5552 0.02% 30 5935 0.02% 31 6020 0.02% 32 6669 0.03% 33 6497 0.03% 34 6993 0.03% 35 6980 0.03% 36 7373 0.03% 37 7616 0.03% 38 8189 0.03% 39 7928 0.03% 40 9039 0.04% 41 9043 0.04% 42 9808 0.04% 43 10418 0.04% 44 10222 0.04% 45 10285 0.04% 46 10754 0.04% 47 10462 0.04% 48 11038 0.04% 49 10919 0.04% 50 11024 0.04% 51 11324 0.04% 52 11403 0.05% 53 11434 0.05% 54 11418 0.05% 55 11198 0.04% 56 11440 0.05% 57 11879 0.05% 58 12717 0.05% 59 12635 0.05% 60 13390 0.05% 61 14009 0.06% 62 14446 0.06% 63 14727 0.06% 64 15099 0.06% 65 16083 0.06% 66 16257 0.06% 67 17087 0.07% 68 17977 0.07% 69 16601 0.07% 70 17731 0.07% 71 18676 0.07% 72 19690 0.08% 73 20579 0.08% 74 21518 0.09% 75 23890 0.09% 76 10757 0.04% 77 12786 0.05% 78 16194 0.06% 79 17965 0.07% 80 19381 0.08% 81 20351 0.08% 82 22634 0.09% 83 23817 0.09% 84 24953 0.10% 85 26862 0.11% 86 28638 0.11% 87 31440 0.12% 88 33520 0.13% 89 36628 0.15% 90 39218 0.16% 91 42662 0.17% 92 48821 0.19% 93 52763 0.21% 94 61193 0.24% 95 68607 0.27% 96 78934 0.31% 97 91205 0.36% 98 97925 0.39% 99 100201 0.40% 100 23587317 93.60% 25200328 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=65.88 fanout-score-rank=2 prefix-density=1.36 prefix-fanout=44.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=88.96 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=11.8 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTTCTTTTACTT Started job on | Feb 11 12:01:17 Started mapping on | Feb 11 12:01:17 Finished on | Feb 11 12:01:56 Mapping speed, Million of reads per hour | 2326.18 Number of input reads | 25200328 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20891058 Uniquely mapped reads % | 82.90% Average mapped length | 98.31 Number of splices: Total | 6126292 Number of splices: Annotated (sjdb) | 5997486 Number of splices: GT/AG | 6025685 Number of splices: GC/AG | 82064 Number of splices: AT/AC | 6504 Number of splices: Non-canonical | 12039 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 740220 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 3400947 % of reads mapped to too many loci | 13.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3569050 3569050 3569050 N_multimapping 740220 740220 740220 N_noFeature 964158 10786504 10932888 N_ambiguous 216597 40947 40226 UnstrandedReadsAssigned:19710303 PositiveStrandReadsAssigned:10063607 NegativeStrandReadsAssigned:9917944 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207888 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207888-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,200,328 reads, 23,318,643 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR3207888.ke.tsv 34699 SRR3207888.se.tsv 87100 total ==> SRR3207888.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1648 46.196 Potri.005G024800.1.v4.1 1035 936 945 54.3098 Potri.004G059700.1.v4.1 961 862 18 1.12328 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 509.269 9.63251 Potri.016G087400.1.v4.1 270 171 733 230.584 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 444.767 14.2922 Potri.012G127500.1.v4.1 977 878 2322 142.262 ==> SRR3207888.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1786 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 494 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 32 SRR3207888 completed mapping pipeline successfully