Starting /dee2/code/volunteer_pipeline.sh SRR3207889 current disk space = 3050725330944 free memory = 1575254168 SRR3207889 SRAfilesize 4bc7147c92cf358c6a90932aefe75e79 SRR3207889.sra SRR3207889.sra file validated SRR3207889 is single end SRR3207889 is conventional basespace SRR3207889 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71675 34.0 33.0 34.0 31.0 34.0 2 33.12525 34.0 34.0 34.0 31.0 34.0 3 33.3875 34.0 34.0 34.0 31.0 34.0 4 36.64 37.0 37.0 37.0 35.0 37.0 5 36.57075 37.0 37.0 37.0 35.0 37.0 6 36.64825 37.0 37.0 37.0 35.0 37.0 7 36.60725 37.0 37.0 37.0 35.0 37.0 8 36.6485 37.0 37.0 37.0 35.0 37.0 9 38.54575 39.0 39.0 39.0 38.0 39.0 10-11 38.566 39.0 39.0 39.0 38.0 39.0 12-13 38.533125 39.0 39.0 39.0 38.0 39.0 14-15 40.24275 41.0 40.0 41.0 39.0 41.0 16-17 40.208875000000006 41.0 40.0 41.0 39.0 41.0 18-19 40.22025 41.0 40.0 41.0 39.0 41.0 20-21 40.196625 41.0 40.0 41.0 39.0 41.0 22-23 40.140375 41.0 40.0 41.0 38.5 41.0 24-25 40.132875 41.0 40.0 41.0 38.5 41.0 26-27 39.99125 41.0 40.0 41.0 38.0 41.0 28-29 39.847125 41.0 40.0 41.0 38.0 41.0 30-31 39.847125000000005 41.0 40.0 41.0 38.0 41.0 32-33 39.796 41.0 40.0 41.0 38.0 41.0 34-35 39.730125 41.0 40.0 41.0 38.0 41.0 36-37 39.572375 41.0 40.0 41.0 37.5 41.0 38-39 39.510625 41.0 40.0 41.0 37.0 41.0 40-41 39.536375 41.0 40.0 41.0 37.0 41.0 42-43 39.4035 41.0 40.0 41.0 37.0 41.0 44-45 39.304500000000004 41.0 39.5 41.0 37.0 41.0 46-47 39.299125000000004 41.0 40.0 41.0 36.0 41.0 48-49 39.332375 41.0 39.5 41.0 37.0 41.0 50-51 39.145375 41.0 39.0 41.0 36.0 41.0 52-53 39.053 41.0 39.0 41.0 35.5 41.0 54-55 38.93025 40.5 39.0 41.0 35.0 41.0 56-57 39.0235 41.0 39.0 41.0 35.0 41.0 58-59 39.032624999999996 41.0 39.0 41.0 35.0 41.0 60-61 38.80775 41.0 38.5 41.0 35.0 41.0 62-63 38.5275 40.0 37.5 41.0 35.0 41.0 64-65 38.170375 39.5 37.0 41.0 35.0 41.0 66-67 37.816625 39.0 36.5 41.0 34.5 41.0 68-69 37.336375000000004 39.0 36.0 41.0 34.0 41.0 70-71 37.033125 37.5 35.0 40.0 34.0 41.0 72-73 36.4925 37.0 35.0 39.0 34.0 41.0 74-75 36.137 36.5 35.0 39.0 34.0 41.0 76-77 34.56 35.5 33.5 37.0 31.0 39.0 78-79 35.241625 36.0 35.0 37.0 33.0 39.0 80-81 35.04375 35.0 35.0 37.0 33.5 39.0 82-83 34.755375 35.0 35.0 36.0 33.5 37.5 84-85 34.463 35.0 35.0 36.0 33.0 37.0 86-87 34.252250000000004 35.0 35.0 36.0 33.0 37.0 88-89 34.065375 35.0 35.0 35.0 33.0 36.0 90-91 33.913124999999994 35.0 35.0 35.0 33.0 36.0 92-93 33.672124999999994 35.0 35.0 35.0 32.5 36.0 94-95 33.498999999999995 35.0 35.0 35.0 32.0 36.0 96-97 33.426 35.0 35.0 35.0 32.0 36.0 98-99 33.312124999999995 35.0 35.0 35.0 32.0 35.0 100 33.263 35.0 35.0 35.0 32.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 1.0 13 2.0 14 4.0 15 2.0 16 2.0 17 3.0 18 4.0 19 2.0 20 1.0 21 6.0 22 5.0 23 6.0 24 9.0 25 8.0 26 13.0 27 8.0 28 16.0 29 19.0 30 18.0 31 31.0 32 35.0 33 45.0 34 70.0 35 127.0 36 238.0 37 751.0 38 1949.0 39 616.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.83966352281417 15.523833800662759 18.149375477950546 43.48712719857252 2 19.975 23.35 37.65 19.025 3 22.825 27.3 26.05 23.825 4 24.675 31.025000000000002 20.424999999999997 23.875 5 24.775 36.15 21.625 17.45 6 18.85 37.25 23.625 20.275000000000002 7 16.650000000000002 17.325 45.45 20.575 8 18.95 23.025000000000002 31.4 26.625 9 21.6 23.0 30.5 24.9 10-11 22.3375 33.2375 23.599999999999998 20.825 12-13 20.2625 25.825 30.5125 23.400000000000002 14-15 20.6375 28.325 29.212500000000002 21.825 16-17 22.0 28.4 27.500000000000004 22.1 18-19 21.5625 28.325 26.875 23.2375 20-21 21.7375 28.212500000000002 27.962500000000002 22.0875 22-23 22.037499999999998 28.8625 27.125 21.975 24-25 21.512500000000003 28.6625 27.575 22.25 26-27 21.7 28.425 28.0625 21.8125 28-29 21.912499999999998 28.95 27.6125 21.525 30-31 21.2375 28.6625 28.237499999999997 21.8625 32-33 21.6125 28.625 28.225 21.5375 34-35 21.8125 28.6875 27.700000000000003 21.8 36-37 21.9 27.875 27.175 23.05 38-39 21.8 28.762500000000003 28.075 21.3625 40-41 22.6 28.6125 26.950000000000003 21.837500000000002 42-43 21.15 28.3125 28.199999999999996 22.3375 44-45 20.837500000000002 29.625 28.025 21.512500000000003 46-47 21.9625 28.487499999999997 27.2625 22.287499999999998 48-49 21.8625 28.025 27.85 22.2625 50-51 22.15 28.537499999999998 27.400000000000002 21.912499999999998 52-53 22.412499999999998 28.499999999999996 27.1625 21.925 54-55 22.475 28.449999999999996 28.037499999999998 21.0375 56-57 21.2625 28.599999999999998 27.9125 22.225 58-59 21.7875 27.212500000000002 28.65 22.35 60-61 21.637500000000003 28.1625 27.800000000000004 22.400000000000002 62-63 22.2 27.975 27.800000000000004 22.025 64-65 22.2 27.762500000000003 28.000000000000004 22.037499999999998 66-67 22.275 28.1 26.8375 22.787499999999998 68-69 22.55 27.750000000000004 27.1375 22.5625 70-71 21.712500000000002 28.6625 27.500000000000004 22.125 72-73 21.925 28.549999999999997 28.4 21.125 74-75 22.075 28.3875 27.8625 21.675 76-77 21.375 27.625 28.262500000000003 22.7375 78-79 22.2125 27.900000000000002 28.325 21.5625 80-81 22.412499999999998 28.000000000000004 27.175 22.412499999999998 82-83 21.987499999999997 28.549999999999997 27.474999999999998 21.987499999999997 84-85 20.8875 28.6125 27.762500000000003 22.7375 86-87 22.3625 28.962500000000002 27.05 21.625 88-89 22.0625 28.825 27.025 22.0875 90-91 22.625 27.925 27.487499999999997 21.9625 92-93 22.325 28.712500000000002 27.900000000000002 21.0625 94-95 22.3 28.212500000000002 27.987499999999997 21.5 96-97 21.762500000000003 28.5875 27.750000000000004 21.9 98-99 23.2125 27.987499999999997 28.249999999999996 20.549999999999997 100 23.25 27.675 28.15 20.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 3.0 25 6.5 26 6.0 27 4.0 28 7.0 29 12.0 30 19.5 31 30.0 32 35.5 33 45.5 34 58.5 35 80.5 36 94.5 37 104.5 38 135.5 39 179.0 40 199.5 41 212.5 42 240.5 43 261.5 44 280.0 45 280.5 46 264.5 47 240.0 48 211.5 49 181.5 50 147.5 51 135.0 52 115.0 53 80.5 54 72.5 55 62.5 56 47.5 57 34.5 58 22.5 59 16.5 60 14.0 61 10.5 62 6.5 63 5.5 64 6.0 65 6.0 66 3.5 67 2.0 68 1.0 69 1.5 70 1.5 71 1.0 72 2.5 73 1.5 74 1.0 75 1.5 76 0.5 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69871955812202 99.275 2 0.2761737383881496 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025106703489831784 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231024 spots for SRR3207889.sra Written 2231024 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra Read 2231022 spots for SRR3207889.sra Written 2231022 spots for SRR3207889.sra SRR ids: ['SRR3207889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0lah27vz SRR3207889.sra spots: 44620442 blocks: [[1, 2231022], [2231023, 4462044], [4462045, 6693066], [6693067, 8924088], [8924089, 11155110], [11155111, 13386132], [13386133, 15617154], [15617155, 17848176], [17848177, 20079198], [20079199, 22310220], [22310221, 24541242], [24541243, 26772264], [26772265, 29003286], [29003287, 31234308], [31234309, 33465330], [33465331, 35696352], [35696353, 37927374], [37927375, 40158396], [40158397, 42389418], [42389419, 44620442]] SRR3207889 file size 11625327 SRR3207889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207889 SRR3207889_1.fastq Input file: SRR3207889_1.fastq trimmed: SRR3207889-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:42:12 2025 >> started Tue Feb 11 12:42:35 2025 >> done (22.767s) 44620442 reads processed; of these: 9610 ( 0.02%) short reads filtered out after trimming by size control 38366 ( 0.09%) empty reads filtered out after trimming by size control 44572466 (99.89%) reads available; of these: 2557217 ( 5.74%) trimmed reads available after processing 42015249 (94.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1175 0.00% 19 1403 0.00% 20 1739 0.00% 21 2212 0.00% 22 3026 0.01% 23 4110 0.01% 24 5372 0.01% 25 7279 0.02% 26 8097 0.02% 27 8188 0.02% 28 7962 0.02% 29 8288 0.02% 30 8547 0.02% 31 8788 0.02% 32 9559 0.02% 33 9638 0.02% 34 10325 0.02% 35 10729 0.02% 36 11152 0.03% 37 11536 0.03% 38 12207 0.03% 39 12272 0.03% 40 13207 0.03% 41 13828 0.03% 42 14506 0.03% 43 15587 0.03% 44 16060 0.04% 45 16075 0.04% 46 17107 0.04% 47 17170 0.04% 48 18036 0.04% 49 18009 0.04% 50 18407 0.04% 51 18603 0.04% 52 19106 0.04% 53 19439 0.04% 54 20124 0.05% 55 19807 0.04% 56 19489 0.04% 57 19651 0.04% 58 20982 0.05% 59 21157 0.05% 60 22063 0.05% 61 22394 0.05% 62 23088 0.05% 63 23784 0.05% 64 23857 0.05% 65 25524 0.06% 66 25714 0.06% 67 26868 0.06% 68 27880 0.06% 69 26921 0.06% 70 28857 0.06% 71 30416 0.07% 72 31592 0.07% 73 33003 0.07% 74 35511 0.08% 75 37120 0.08% 76 18579 0.04% 77 21613 0.05% 78 25971 0.06% 79 28914 0.06% 80 31395 0.07% 81 32821 0.07% 82 35291 0.08% 83 38940 0.09% 84 39781 0.09% 85 42662 0.10% 86 45128 0.10% 87 48887 0.11% 88 53266 0.12% 89 57252 0.13% 90 61966 0.14% 91 67208 0.15% 92 75210 0.17% 93 83177 0.19% 94 95638 0.21% 95 107653 0.24% 96 125315 0.28% 97 142172 0.32% 98 154708 0.35% 99 159124 0.36% 100 42015249 94.26% 44572466 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=63.62 fanout-score-rank=6 prefix-density=0.68 prefix-fanout=41.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=195.68 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=23.0 sequence=AAGAAGAAGAAA Started job on | Feb 11 12:42:53 Started mapping on | Feb 11 12:42:53 Finished on | Feb 11 12:43:30 Mapping speed, Million of reads per hour | 4336.78 Number of input reads | 44572466 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 42416091 Uniquely mapped reads % | 95.16% Average mapped length | 98.40 Number of splices: Total | 11401971 Number of splices: Annotated (sjdb) | 11188069 Number of splices: GT/AG | 11224388 Number of splices: GC/AG | 143859 Number of splices: AT/AC | 12826 Number of splices: Non-canonical | 20898 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.05 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1091014 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 770902 % of reads mapped to too many loci | 1.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1065361 1065361 1065361 N_multimapping 1091014 1091014 1091014 N_noFeature 1948849 21918659 22129235 N_ambiguous 472114 77998 77748 UnstrandedReadsAssigned:39995128 PositiveStrandReadsAssigned:20419434 NegativeStrandReadsAssigned:20209108 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207889 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207889-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,572,466 reads, 41,561,685 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,266 rounds 52401 SRR3207889.ke.tsv 34699 SRR3207889.se.tsv 87100 total ==> SRR3207889.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2493 42.57 Potri.005G024800.1.v4.1 1035 936 939 32.8735 Potri.004G059700.1.v4.1 961 862 125 4.75181 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 714.788 8.23577 Potri.016G087400.1.v4.1 270 171 1781 341.29 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 155.496 3.04382 Potri.012G127500.1.v4.1 977 878 6752 251.996 ==> SRR3207889.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4721 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 933 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 120 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR3207889 completed mapping pipeline successfully