Starting /dee2/code/volunteer_pipeline.sh SRR3207890 current disk space = 3051232702464 free memory = 1446815048 SRR3207890 SRAfilesize 4ea9a91f8abb2e582feaa3e31aa38997 SRR3207890.sra SRR3207890.sra file validated SRR3207890 is single end SRR3207890 is conventional basespace SRR3207890 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207890_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61075 34.0 33.0 34.0 31.0 34.0 2 33.04275 34.0 34.0 34.0 31.0 34.0 3 33.3685 34.0 34.0 34.0 31.0 34.0 4 36.6445 37.0 37.0 37.0 35.0 37.0 5 36.592 37.0 37.0 37.0 35.0 37.0 6 36.64375 37.0 37.0 37.0 35.0 37.0 7 36.642 37.0 37.0 37.0 35.0 37.0 8 36.6685 37.0 37.0 37.0 35.0 37.0 9 38.56275 39.0 39.0 39.0 38.0 39.0 10-11 38.5975 39.0 39.0 39.0 38.0 39.0 12-13 38.577625 39.0 39.0 39.0 38.0 39.0 14-15 40.262625 41.0 40.0 41.0 39.0 41.0 16-17 40.232625 41.0 40.0 41.0 39.0 41.0 18-19 40.248875 41.0 40.0 41.0 39.0 41.0 20-21 40.198499999999996 41.0 40.0 41.0 39.0 41.0 22-23 40.141000000000005 41.0 40.0 41.0 38.5 41.0 24-25 40.10525 41.0 40.0 41.0 38.5 41.0 26-27 39.980875 41.0 40.0 41.0 38.0 41.0 28-29 39.8155 41.0 40.0 41.0 38.0 41.0 30-31 39.805 41.0 40.0 41.0 38.0 41.0 32-33 39.770625 41.0 40.0 41.0 38.0 41.0 34-35 39.727125 41.0 40.0 41.0 38.0 41.0 36-37 39.529624999999996 41.0 40.0 41.0 37.0 41.0 38-39 39.42125 41.0 40.0 41.0 37.0 41.0 40-41 39.408500000000004 41.0 40.0 41.0 37.0 41.0 42-43 39.316125 41.0 39.5 41.0 36.5 41.0 44-45 39.22025 41.0 39.5 41.0 36.0 41.0 46-47 39.183125000000004 41.0 39.0 41.0 36.5 41.0 48-49 39.224000000000004 41.0 39.0 41.0 36.0 41.0 50-51 39.117875 41.0 39.0 41.0 35.5 41.0 52-53 38.947625 41.0 39.0 41.0 35.0 41.0 54-55 38.831625 40.5 39.0 41.0 35.0 41.0 56-57 38.89325 41.0 39.0 41.0 35.0 41.0 58-59 38.953125 41.0 39.0 41.0 35.0 41.0 60-61 38.715125 40.5 38.0 41.0 35.0 41.0 62-63 38.492999999999995 40.0 37.5 41.0 35.0 41.0 64-65 38.154624999999996 39.5 37.0 41.0 35.0 41.0 66-67 37.77675 39.0 36.5 41.0 34.5 41.0 68-69 37.310625 39.0 36.0 41.0 34.0 41.0 70-71 36.984750000000005 37.5 35.0 40.0 34.0 41.0 72-73 36.448750000000004 37.0 35.0 39.0 33.5 41.0 74-75 35.99225 36.5 35.0 39.0 33.5 40.5 76-77 34.3735 35.0 33.5 37.0 30.5 39.0 78-79 35.140249999999995 36.0 35.0 37.0 33.0 39.0 80-81 34.94825 35.0 35.0 37.0 33.5 39.0 82-83 34.69025 35.0 35.0 36.0 33.0 37.0 84-85 34.456 35.0 35.0 36.0 33.0 37.0 86-87 34.1995 35.0 35.0 36.0 33.0 37.0 88-89 34.068375 35.0 35.0 35.0 33.0 36.0 90-91 33.85325 35.0 35.0 35.0 33.0 36.0 92-93 33.63849999999999 35.0 35.0 35.0 32.5 36.0 94-95 33.474125 35.0 35.0 35.0 32.0 36.0 96-97 33.405375 35.0 35.0 35.0 32.0 35.0 98-99 33.317875 35.0 35.0 35.0 32.0 35.0 100 33.252 35.0 35.0 35.0 32.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 2.0 10 2.0 11 2.0 12 3.0 13 3.0 14 0.0 15 5.0 16 3.0 17 2.0 18 3.0 19 3.0 20 5.0 21 5.0 22 3.0 23 4.0 24 7.0 25 10.0 26 8.0 27 17.0 28 15.0 29 10.0 30 20.0 31 35.0 32 43.0 33 46.0 34 65.0 35 139.0 36 258.0 37 777.0 38 1926.0 39 575.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.044989775051125 14.340490797546012 18.25153374233129 40.36298568507157 2 18.85 24.25 36.199999999999996 20.7 3 20.474999999999998 27.950000000000003 28.475 23.1 4 23.825 32.525 21.125 22.525000000000002 5 25.756439109777446 34.808702175543885 22.55563890972743 16.879219804951237 6 18.3 38.775 24.0 18.925 7 16.575 18.224999999999998 44.775 20.424999999999997 8 19.625 24.45 28.9 27.025 9 20.849999999999998 21.875 32.45 24.825 10-11 22.5875 33.525 23.025000000000002 20.8625 12-13 20.9 26.5125 29.562500000000004 23.025000000000002 14-15 21.2625 27.6625 29.275000000000002 21.8 16-17 22.325 27.474999999999998 28.625 21.575 18-19 22.237499999999997 27.975 28.025 21.762500000000003 20-21 22.3625 28.349999999999998 26.8625 22.425 22-23 22.037499999999998 28.975 27.962500000000002 21.025 24-25 21.4125 28.249999999999996 27.675 22.662499999999998 26-27 22.3 28.4 27.700000000000003 21.6 28-29 22.1875 27.712500000000002 27.987499999999997 22.112499999999997 30-31 20.9375 28.9125 28.1625 21.987499999999997 32-33 21.1875 28.125 27.987499999999997 22.7 34-35 21.5 29.25 27.5625 21.6875 36-37 22.1375 27.375 28.075 22.412499999999998 38-39 22.037499999999998 29.025000000000002 27.1125 21.825 40-41 21.725 27.200000000000003 27.9375 23.1375 42-43 21.25 28.6375 28.3625 21.75 44-45 22.5625 27.462500000000002 27.1 22.875 46-47 22.400000000000002 27.575 28.225 21.8 48-49 22.25 26.987499999999997 28.549999999999997 22.2125 50-51 22.037499999999998 27.8375 28.225 21.9 52-53 22.0 28.1375 27.975 21.8875 54-55 21.4125 28.3875 27.525 22.675 56-57 21.1125 28.475 28.537499999999998 21.875 58-59 23.0125 27.487499999999997 27.1625 22.3375 60-61 21.8125 27.650000000000002 28.275 22.2625 62-63 22.3875 28.4125 27.925 21.275 64-65 21.675 28.050000000000004 27.0 23.275000000000002 66-67 20.6375 28.249999999999996 28.475 22.6375 68-69 22.05 26.7625 29.037499999999998 22.15 70-71 21.140142517814727 28.353544193024128 28.59107388423553 21.915239404925615 72-73 22.075 28.549999999999997 27.5625 21.8125 74-75 21.2875 28.9125 28.0875 21.712500000000002 76-77 21.45 28.599999999999998 28.075 21.875 78-79 22.1875 28.487499999999997 27.8125 21.512500000000003 80-81 22.0 28.012500000000003 28.5625 21.425 82-83 21.4 28.000000000000004 28.6625 21.9375 84-85 22.2 28.1 28.375 21.325 86-87 22.412499999999998 27.037499999999998 28.3125 22.237499999999997 88-89 22.2125 27.875 28.15 21.762500000000003 90-91 20.9875 28.9 28.0625 22.05 92-93 22.5 28.0625 28.075 21.3625 94-95 21.8125 28.1625 28.175 21.85 96-97 21.825 27.750000000000004 28.8875 21.5375 98-99 22.037499999999998 28.8625 27.3875 21.712500000000002 100 22.525000000000002 29.299999999999997 26.924999999999997 21.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 3.0 25 3.5 26 2.5 27 5.0 28 10.0 29 16.5 30 22.5 31 27.5 32 39.0 33 51.0 34 53.5 35 74.0 36 103.0 37 123.0 38 140.0 39 163.5 40 192.0 41 224.5 42 247.5 43 262.0 44 274.0 45 278.0 46 265.5 47 231.0 48 209.0 49 187.0 50 160.0 51 133.0 52 104.5 53 83.0 54 69.5 55 52.0 56 34.0 57 31.5 58 25.5 59 18.5 60 18.0 61 13.5 62 9.0 63 7.5 64 5.5 65 4.5 66 3.0 67 1.5 68 1.0 69 2.0 70 3.0 71 1.5 72 2.5 73 2.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265096 spots for SRR3207890.sra Written 2265096 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra Read 2265090 spots for SRR3207890.sra Written 2265090 spots for SRR3207890.sra SRR ids: ['SRR3207890.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nmfczeyk SRR3207890.sra spots: 45301806 blocks: [[1, 2265090], [2265091, 4530180], [4530181, 6795270], [6795271, 9060360], [9060361, 11325450], [11325451, 13590540], [13590541, 15855630], [15855631, 18120720], [18120721, 20385810], [20385811, 22650900], [22650901, 24915990], [24915991, 27181080], [27181081, 29446170], [29446171, 31711260], [31711261, 33976350], [33976351, 36241440], [36241441, 38506530], [38506531, 40771620], [40771621, 43036710], [43036711, 45301806]] SRR3207890 file size 11802984 SRR3207890 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207890 SRR3207890_1.fastq Input file: SRR3207890_1.fastq trimmed: SRR3207890-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:01:49 2025 >> started Tue Feb 11 12:02:11 2025 >> done (22.133s) 45301806 reads processed; of these: 9879 ( 0.02%) short reads filtered out after trimming by size control 27442 ( 0.06%) empty reads filtered out after trimming by size control 45264485 (99.92%) reads available; of these: 2499603 ( 5.52%) trimmed reads available after processing 42764882 (94.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1258 0.00% 19 1543 0.00% 20 2021 0.00% 21 2150 0.00% 22 3009 0.01% 23 3911 0.01% 24 5443 0.01% 25 6877 0.02% 26 7806 0.02% 27 7689 0.02% 28 7821 0.02% 29 7910 0.02% 30 8592 0.02% 31 8701 0.02% 32 9466 0.02% 33 9625 0.02% 34 10251 0.02% 35 10441 0.02% 36 11180 0.02% 37 11636 0.03% 38 12090 0.03% 39 12328 0.03% 40 13282 0.03% 41 13586 0.03% 42 14448 0.03% 43 15258 0.03% 44 15667 0.03% 45 16061 0.04% 46 16968 0.04% 47 17114 0.04% 48 17694 0.04% 49 17879 0.04% 50 17991 0.04% 51 18312 0.04% 52 18696 0.04% 53 19103 0.04% 54 19386 0.04% 55 19226 0.04% 56 18901 0.04% 57 19318 0.04% 58 20254 0.04% 59 20525 0.05% 60 21188 0.05% 61 22104 0.05% 62 22909 0.05% 63 23178 0.05% 64 23430 0.05% 65 24531 0.05% 66 24759 0.05% 67 25822 0.06% 68 26575 0.06% 69 26229 0.06% 70 28084 0.06% 71 29259 0.06% 72 30650 0.07% 73 32157 0.07% 74 34431 0.08% 75 35675 0.08% 76 18232 0.04% 77 21021 0.05% 78 25424 0.06% 79 27684 0.06% 80 30679 0.07% 81 31933 0.07% 82 34111 0.08% 83 37487 0.08% 84 38394 0.08% 85 41261 0.09% 86 43226 0.10% 87 48004 0.11% 88 51811 0.11% 89 55788 0.12% 90 60261 0.13% 91 65442 0.14% 92 73676 0.16% 93 81148 0.18% 94 93087 0.21% 95 105848 0.23% 96 123070 0.27% 97 139513 0.31% 98 152677 0.34% 99 157428 0.35% 100 42764882 94.48% 45264485 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=55.82 fanout-score-rank=9 prefix-density=0.52 prefix-fanout=38.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=265.65 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.9 sequence=TTCTTCTTCTTTT Started job on | Feb 11 12:02:28 Started mapping on | Feb 11 12:02:29 Finished on | Feb 11 12:03:07 Mapping speed, Million of reads per hour | 4288.21 Number of input reads | 45264485 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 42625920 Uniquely mapped reads % | 94.17% Average mapped length | 98.48 Number of splices: Total | 11292267 Number of splices: Annotated (sjdb) | 11065376 Number of splices: GT/AG | 11114238 Number of splices: GC/AG | 143368 Number of splices: AT/AC | 13325 Number of splices: Non-canonical | 21336 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1161916 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 1177954 % of reads mapped to too many loci | 2.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1476649 1476649 1476649 N_multimapping 1161916 1161916 1161916 N_noFeature 2061899 22121980 22290913 N_ambiguous 432268 78962 79068 UnstrandedReadsAssigned:40131753 PositiveStrandReadsAssigned:20424978 NegativeStrandReadsAssigned:20255939 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207890 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207890-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,264,485 reads, 42,052,726 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,266 rounds 52401 SRR3207890.ke.tsv 34699 SRR3207890.se.tsv 87100 total ==> SRR3207890.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 4378 75.8809 Potri.005G024800.1.v4.1 1035 936 2730 97.0104 Potri.004G059700.1.v4.1 961 862 82 3.16401 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 940.467 10.9988 Potri.016G087400.1.v4.1 270 171 1745 339.415 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 150.281 2.98594 Potri.012G127500.1.v4.1 977 878 6747 255.592 ==> SRR3207890.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3470 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 696 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 58 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207890 completed mapping pipeline successfully