Starting /dee2/code/volunteer_pipeline.sh SRR3207891 current disk space = 3051091558400 free memory = 1415469284 SRR3207891 SRAfilesize fc517020844c8c0f097df0eff52d931a SRR3207891.sra SRR3207891.sra file validated SRR3207891 is single end SRR3207891 is conventional basespace SRR3207891 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207891_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.713 34.0 31.0 34.0 31.0 34.0 2 32.83975 34.0 31.0 34.0 31.0 34.0 3 32.8505 34.0 31.0 34.0 31.0 34.0 4 36.15275 37.0 37.0 37.0 35.0 37.0 5 36.158 37.0 37.0 37.0 35.0 37.0 6 36.13 37.0 37.0 37.0 35.0 37.0 7 36.13425 37.0 37.0 37.0 35.0 37.0 8 36.179 37.0 37.0 37.0 35.0 37.0 9 37.91 39.0 38.0 39.0 35.0 39.0 10-11 38.005125 39.0 38.5 39.0 35.5 39.0 12-13 37.95325 39.0 38.0 39.0 35.0 39.0 14-15 39.432500000000005 41.0 39.5 41.0 36.5 41.0 16-17 39.377250000000004 41.0 39.0 41.0 36.5 41.0 18-19 39.435 41.0 39.5 41.0 36.0 41.0 20-21 39.35825 41.0 39.0 41.0 36.0 41.0 22-23 39.325500000000005 41.0 39.0 41.0 36.0 41.0 24-25 38.6315 41.0 39.0 41.0 35.5 41.0 26-27 39.025625000000005 41.0 39.0 41.0 35.5 41.0 28-29 39.01525 40.5 39.0 41.0 35.5 41.0 30-31 38.861625000000004 40.0 38.5 41.0 35.0 41.0 32-33 38.95975 40.0 39.0 41.0 35.0 41.0 34-35 38.864000000000004 40.0 38.5 41.0 35.0 41.0 36-37 38.727374999999995 40.0 38.0 41.0 35.0 41.0 38-39 38.598625 40.0 38.0 41.0 35.0 41.0 40-41 38.507875 40.0 38.0 41.0 34.5 41.0 42-43 38.447874999999996 40.0 38.0 41.0 34.5 41.0 44-45 38.2205 40.0 38.0 41.0 34.0 41.0 46-47 37.93962500000001 40.0 38.0 41.0 33.0 41.0 48-49 37.47125 40.0 37.5 41.0 32.5 41.0 50-51 37.32675 40.0 37.5 41.0 32.0 41.0 52-53 37.4185 40.0 37.0 41.0 31.5 41.0 54-55 37.49625 40.0 37.0 41.0 32.0 41.0 56-57 37.369125 39.5 36.5 41.0 32.0 41.0 58-59 37.05200000000001 39.0 36.0 41.0 31.5 41.0 60-61 37.048125 39.0 36.0 41.0 31.5 41.0 62-63 37.190125 39.0 35.5 41.0 32.5 41.0 64-65 36.951625 39.0 35.0 41.0 32.0 41.0 66-67 36.636250000000004 38.5 35.0 40.5 32.0 41.0 68-69 36.295125 37.0 35.0 40.0 32.0 41.0 70-71 35.894875 37.0 35.0 39.0 31.5 41.0 72-73 35.496875 36.5 35.0 39.0 31.0 41.0 74-75 34.868875 36.0 34.5 38.5 30.5 39.5 76-77 33.17575 34.5 32.0 36.5 27.5 39.0 78-79 34.16825 35.0 34.0 37.0 30.0 39.0 80-81 33.995999999999995 35.0 34.0 36.5 30.0 38.0 82-83 33.573125 35.0 34.0 36.0 29.5 37.0 84-85 33.37175 35.0 34.0 36.0 29.5 37.0 86-87 33.2325 35.0 34.0 35.0 29.5 36.5 88-89 33.09975 35.0 34.0 35.0 30.0 36.0 90-91 32.843125 35.0 34.0 35.0 29.0 36.0 92-93 32.689 35.0 34.0 35.0 29.0 36.0 94-95 32.617375 35.0 34.0 35.0 29.0 35.0 96-97 32.482875 35.0 34.0 35.0 29.0 35.0 98-99 32.191625 35.0 33.0 35.0 29.0 35.0 100 31.92525 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 3.0 10 1.0 11 4.0 12 3.0 13 4.0 14 1.0 15 6.0 16 3.0 17 1.0 18 5.0 19 6.0 20 7.0 21 7.0 22 10.0 23 11.0 24 13.0 25 15.0 26 12.0 27 21.0 28 21.0 29 28.0 30 64.0 31 71.0 32 82.0 33 144.0 34 178.0 35 281.0 36 404.0 37 899.0 38 1374.0 39 312.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.450000000000003 14.95 17.2 41.4 2 19.525000000000002 24.5 37.4 18.575 3 22.775000000000002 27.575 26.575 23.075000000000003 4 25.45 32.65 19.425 22.475 5 25.43815723585378 34.651977966950426 21.331997996995494 18.5778668002003 6 18.575 37.974999999999994 24.05 19.400000000000002 7 16.7 18.55 43.1 21.65 8 19.25 21.875 29.549999999999997 29.325000000000003 9 20.8 22.425 31.874999999999996 24.9 10-11 23.3 32.800000000000004 22.1375 21.762500000000003 12-13 21.425 26.525 28.975 23.075000000000003 14-15 21.875 27.35 28.075 22.7 16-17 21.987499999999997 27.8375 27.287499999999998 22.8875 18-19 21.987499999999997 28.499999999999996 26.8125 22.7 20-21 23.1125 28.212500000000002 27.025 21.65 22-23 21.9625 27.85 28.1375 22.05 24-25 21.54507523074978 28.562397268934127 28.284233152105198 21.608294348210897 26-27 21.987499999999997 28.325 27.6 22.0875 28-29 21.7375 28.4 27.825 22.037499999999998 30-31 22.375 27.2625 27.725 22.6375 32-33 22.287499999999998 28.849999999999998 27.35 21.512500000000003 34-35 22.3125 28.812500000000004 26.9625 21.912499999999998 36-37 21.4875 28.512500000000003 27.450000000000003 22.55 38-39 22.287499999999998 27.8625 26.950000000000003 22.900000000000002 40-41 22.5875 27.425 26.8375 23.150000000000002 42-43 21.462500000000002 28.287499999999998 27.437499999999996 22.8125 44-45 22.400000000000002 28.675 28.225 20.7 46-47 21.844113599399474 28.08707619166771 27.974477667959462 22.09433254097335 48-49 21.744112030553786 27.001909611712282 27.702100572883516 23.551877784850415 50-51 20.78466226510919 27.958354494667343 28.872524123920773 22.38445911630269 52-53 22.169398223445516 28.650068810208936 27.686725885149503 21.493807081196046 54-55 21.85 28.1125 28.012500000000003 22.025 56-57 22.3875 27.3875 28.462500000000002 21.762500000000003 58-59 21.95 27.925 28.275 21.85 60-61 22.275 26.8375 28.1 22.787499999999998 62-63 22.5125 28.325 27.6625 21.5 64-65 22.375 28.1125 27.05 22.4625 66-67 22.675 27.6625 27.275 22.3875 68-69 22.175 27.875 28.037499999999998 21.912499999999998 70-71 21.65 28.599999999999998 27.9375 21.8125 72-73 22.2 27.4125 27.700000000000003 22.6875 74-75 21.725 28.075 28.475 21.725 76-77 21.3 29.175 27.175 22.35 78-79 22.35 26.987499999999997 28.762500000000003 21.9 80-81 22.4375 27.1 27.875 22.5875 82-83 21.65 27.975 27.3875 22.9875 84-85 21.9 28.037499999999998 27.9125 22.15 86-87 21.85 27.6875 28.6125 21.85 88-89 21.275 27.950000000000003 27.875 22.900000000000002 90-91 21.925 27.987499999999997 27.6875 22.400000000000002 92-93 22.0625 27.737499999999997 28.1125 22.0875 94-95 22.375 27.875 27.5625 22.1875 96-97 21.987499999999997 27.737499999999997 27.6875 22.5875 98-99 22.8875 28.1 26.775 22.237499999999997 100 22.400000000000002 27.150000000000002 27.325 23.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 3.0 26 3.0 27 4.5 28 9.0 29 10.0 30 17.0 31 31.5 32 32.5 33 42.0 34 70.0 35 85.5 36 105.5 37 126.0 38 141.5 39 184.0 40 203.0 41 211.5 42 226.5 43 229.5 44 247.0 45 242.0 46 233.0 47 231.5 48 199.5 49 171.5 50 157.0 51 133.5 52 110.0 53 91.5 54 87.0 55 76.0 56 53.0 57 40.0 58 34.5 59 35.5 60 26.5 61 15.0 62 11.5 63 8.5 64 7.0 65 4.0 66 3.0 67 2.5 68 5.5 69 7.5 70 4.5 71 2.5 72 1.5 73 1.5 74 2.0 75 2.0 76 1.0 77 0.5 78 1.0 79 0.5 80 0.5 81 1.5 82 1.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 1.1375 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.08750000000000001 48-49 1.8124999999999998 50-51 1.55 52-53 0.08750000000000001 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.6625 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935864 spots for SRR3207891.sra Written 1935864 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra Read 1935849 spots for SRR3207891.sra Written 1935849 spots for SRR3207891.sra SRR ids: ['SRR3207891.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ibfll7cg SRR3207891.sra spots: 38716995 blocks: [[1, 1935849], [1935850, 3871698], [3871699, 5807547], [5807548, 7743396], [7743397, 9679245], [9679246, 11615094], [11615095, 13550943], [13550944, 15486792], [15486793, 17422641], [17422642, 19358490], [19358491, 21294339], [21294340, 23230188], [23230189, 25166037], [25166038, 27101886], [27101887, 29037735], [29037736, 30973584], [30973585, 32909433], [32909434, 34845282], [34845283, 36781131], [36781132, 38716995]] SRR3207891 file size 10064872 SRR3207891 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207891 SRR3207891_1.fastq Input file: SRR3207891_1.fastq trimmed: SRR3207891-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 12:12:21 2025 >> started Tue Feb 11 12:12:41 2025 >> done (20.184s) 38716995 reads processed; of these: 7740 ( 0.02%) short reads filtered out after trimming by size control 80670 ( 0.21%) empty reads filtered out after trimming by size control 38628585 (99.77%) reads available; of these: 2091233 ( 5.41%) trimmed reads available after processing 36537352 (94.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1032 0.00% 19 1229 0.00% 20 1389 0.00% 21 1786 0.00% 22 2231 0.01% 23 2945 0.01% 24 3845 0.01% 25 5066 0.01% 26 5408 0.01% 27 5250 0.01% 28 5102 0.01% 29 5245 0.01% 30 5590 0.01% 31 5554 0.01% 32 5805 0.02% 33 5924 0.02% 34 6124 0.02% 35 6481 0.02% 36 6815 0.02% 37 7137 0.02% 38 7493 0.02% 39 7852 0.02% 40 8284 0.02% 41 8740 0.02% 42 8715 0.02% 43 9101 0.02% 44 9331 0.02% 45 9996 0.03% 46 9764 0.03% 47 10098 0.03% 48 11344 0.03% 49 11063 0.03% 50 11079 0.03% 51 11941 0.03% 52 11987 0.03% 53 13253 0.03% 54 13570 0.04% 55 14635 0.04% 56 13050 0.03% 57 13309 0.03% 58 13849 0.04% 59 15047 0.04% 60 12888 0.03% 61 13691 0.04% 62 14263 0.04% 63 15169 0.04% 64 16134 0.04% 65 16520 0.04% 66 17428 0.05% 67 18269 0.05% 68 20011 0.05% 69 17075 0.04% 70 17912 0.05% 71 18881 0.05% 72 19830 0.05% 73 21118 0.05% 74 22064 0.06% 75 23346 0.06% 76 12061 0.03% 77 14334 0.04% 78 17430 0.05% 79 19335 0.05% 80 20885 0.05% 81 23898 0.06% 82 24160 0.06% 83 25951 0.07% 84 28435 0.07% 85 31371 0.08% 86 33537 0.09% 87 35734 0.09% 88 41364 0.11% 89 43051 0.11% 90 47923 0.12% 91 54093 0.14% 92 64182 0.17% 93 72208 0.19% 94 83993 0.22% 95 100657 0.26% 96 121681 0.32% 97 153625 0.40% 98 188902 0.49% 99 214365 0.55% 100 36537352 94.59% 38628585 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=62.34 fanout-score-rank=3 prefix-density=0.96 prefix-fanout=42.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=12 fanout-score=196.12 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=20.8 sequence=TCTTCTTCTTTGCTGCGCTCTCCGCTTATCTGCAGAACTCTTTGGCCCTCTTCCAACTCTATTTTCACCTCTTCCTTCTTCAAACCTGGAAGATCAGC Started job on | Feb 11 12:13:53 Started mapping on | Feb 11 12:13:53 Finished on | Feb 11 12:16:05 Mapping speed, Million of reads per hour | 1053.51 Number of input reads | 38628585 Average input read length | 91 UNIQUE READS: Uniquely mapped reads number | 15153060 Uniquely mapped reads % | 39.23% Average mapped length | 90.58 Number of splices: Total | 3788932 Number of splices: Annotated (sjdb) | 3698378 Number of splices: GT/AG | 3724362 Number of splices: GC/AG | 51627 Number of splices: AT/AC | 4813 Number of splices: Non-canonical | 8130 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.02% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 552715 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 1118214 % of reads mapped to too many loci | 2.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 56.40% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 22922810 22922810 22922810 N_multimapping 552715 552715 552715 N_noFeature 866492 7906442 8018270 N_ambiguous 152887 29220 29089 UnstrandedReadsAssigned:14133681 PositiveStrandReadsAssigned:7217398 NegativeStrandReadsAssigned:7105701 Dataset is classified unstranded MeadianReadLen=92 20thPercentileLength=92 echo kmer=87 SRR3207891 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207891-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,628,585 reads, 15,309,152 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52401 SRR3207891.ke.tsv 34699 SRR3207891.se.tsv 87100 total ==> SRR3207891.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1041 47.1148 Potri.005G024800.1.v4.1 1035 936 2198 203.955 Potri.004G059700.1.v4.1 961 862 32 3.22422 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 521.227 15.9177 Potri.016G087400.1.v4.1 270 171 517 262.589 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 84.7233 4.39571 Potri.012G127500.1.v4.1 977 878 4709 465.818 ==> SRR3207891.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1084 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 42 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207891 completed mapping pipeline successfully