Starting /dee2/code/volunteer_pipeline.sh SRR3207892 current disk space = 3050338873344 free memory = 1580087148 SRR3207892 SRAfilesize e9f56c68544f4807b1da37c08edfbda6 SRR3207892.sra SRR3207892.sra file validated SRR3207892 is single end SRR3207892 is conventional basespace SRR3207892 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207892_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.595 34.0 31.0 34.0 31.0 34.0 2 32.765 34.0 31.0 34.0 31.0 34.0 3 32.75375 34.0 31.0 34.0 31.0 34.0 4 36.05175 37.0 37.0 37.0 35.0 37.0 5 36.124 37.0 37.0 37.0 35.0 37.0 6 36.1545 37.0 37.0 37.0 35.0 37.0 7 36.183 37.0 37.0 37.0 35.0 37.0 8 36.183 37.0 37.0 37.0 35.0 37.0 9 37.94625 39.0 38.0 39.0 35.0 39.0 10-11 37.946375 39.0 38.0 39.0 35.0 39.0 12-13 37.904875000000004 39.0 38.0 39.0 35.0 39.0 14-15 39.382374999999996 41.0 39.0 41.0 36.0 41.0 16-17 39.260000000000005 41.0 39.0 41.0 36.0 41.0 18-19 39.296 41.0 39.0 41.0 36.0 41.0 20-21 39.276125 41.0 39.0 41.0 36.0 41.0 22-23 39.350875 41.0 39.0 41.0 36.0 41.0 24-25 38.830625 41.0 39.0 41.0 36.0 41.0 26-27 39.0345 40.5 39.0 41.0 35.5 41.0 28-29 39.013125 40.0 39.0 41.0 35.5 41.0 30-31 38.899874999999994 40.0 38.5 41.0 35.0 41.0 32-33 38.8575 40.0 38.0 41.0 35.0 41.0 34-35 38.884875 40.0 38.0 41.0 35.0 41.0 36-37 38.662375 40.0 38.0 41.0 35.0 41.0 38-39 38.543625000000006 40.0 38.0 41.0 34.0 41.0 40-41 38.471125 40.0 38.0 41.0 34.0 41.0 42-43 38.38075 40.0 38.0 41.0 34.0 41.0 44-45 38.133250000000004 40.0 38.0 41.0 33.5 41.0 46-47 37.848625 40.0 38.0 41.0 33.0 41.0 48-49 37.54725 40.0 37.5 41.0 33.0 41.0 50-51 37.446124999999995 40.0 37.0 41.0 32.5 41.0 52-53 37.350750000000005 40.0 37.0 41.0 31.5 41.0 54-55 37.366749999999996 39.5 36.5 41.0 32.0 41.0 56-57 37.281125 39.0 36.0 41.0 31.5 41.0 58-59 36.940625 39.0 36.0 41.0 31.0 41.0 60-61 36.89675 39.0 35.5 41.0 31.5 41.0 62-63 37.041 39.0 35.5 41.0 31.5 41.0 64-65 36.838375 39.0 35.0 41.0 32.0 41.0 66-67 36.523875000000004 38.0 35.0 40.0 31.5 41.0 68-69 36.149874999999994 37.0 35.0 40.0 31.0 41.0 70-71 35.692375 37.0 35.0 39.0 31.0 41.0 72-73 35.30825 36.0 35.0 39.0 31.0 41.0 74-75 34.73125 36.0 34.5 38.5 29.5 39.5 76-77 33.044375 34.5 32.0 36.0 27.5 39.0 78-79 33.97575 35.0 34.0 37.0 29.5 39.0 80-81 33.86225 35.0 34.0 36.5 30.0 38.5 82-83 33.408875 35.0 34.0 36.0 29.0 37.0 84-85 33.177625000000006 35.0 34.0 36.0 29.0 37.0 86-87 33.016875 35.0 34.0 35.0 29.0 36.5 88-89 32.923500000000004 35.0 34.0 35.0 29.0 36.0 90-91 32.6535 35.0 33.5 35.0 29.0 36.0 92-93 32.49625 35.0 33.0 35.0 29.0 36.0 94-95 32.414500000000004 35.0 34.0 35.0 29.0 35.5 96-97 32.241 35.0 33.0 35.0 29.0 35.0 98-99 32.055 35.0 33.0 35.0 28.0 35.0 100 31.8665 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 3.0 11 3.0 12 1.0 13 2.0 14 4.0 15 5.0 16 9.0 17 7.0 18 4.0 19 5.0 20 7.0 21 5.0 22 11.0 23 12.0 24 18.0 25 12.0 26 17.0 27 30.0 28 27.0 29 50.0 30 50.0 31 72.0 32 88.0 33 134.0 34 192.0 35 251.0 36 450.0 37 867.0 38 1358.0 39 300.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.15 14.649999999999999 18.65 41.55 2 20.1 23.625 36.85 19.425 3 22.425 25.974999999999998 27.775 23.825 4 24.675 32.875 20.474999999999998 21.975 5 24.862431215607803 35.14257128564282 21.660830415207606 18.33416708354177 6 18.75 37.075 24.0 20.175 7 16.7 17.45 45.025 20.825 8 19.0 23.125 29.325000000000003 28.549999999999997 9 20.375 22.25 31.175000000000004 26.200000000000003 10-11 22.3625 34.325 21.912499999999998 21.4 12-13 21.099999999999998 26.5125 29.849999999999998 22.537499999999998 14-15 22.1875 28.025 27.525 22.2625 16-17 21.95 28.1625 28.012500000000003 21.875 18-19 23.2625 27.0125 27.375 22.35 20-21 22.3125 28.000000000000004 27.625 22.0625 22-23 20.724999999999998 28.9875 27.6625 22.625 24-25 22.784012104400453 27.852729794477366 27.51229353171101 21.850964569411172 26-27 22.025 27.975 26.937499999999996 23.0625 28-29 22.112499999999997 28.325 27.6 21.9625 30-31 21.825 28.475 27.250000000000004 22.45 32-33 21.625 28.5875 28.4 21.3875 34-35 22.287499999999998 28.6125 26.674999999999997 22.425 36-37 22.5625 27.700000000000003 27.750000000000004 21.987499999999997 38-39 22.6125 28.249999999999996 27.325 21.8125 40-41 22.5875 27.275 28.025 22.112499999999997 42-43 21.75 28.537499999999998 27.925 21.7875 44-45 22.112499999999997 29.099999999999998 26.7625 22.025 46-47 22.078897933625548 27.426424546023792 27.67689417658109 22.81778334376957 48-49 20.74609821088694 28.43547773125238 27.674153026265703 23.144271031594975 50-51 22.36992024306874 27.97822509178377 27.573110520319027 22.07874414482846 52-53 22.204132748904197 28.12773951158422 27.163431433938634 22.50469630557295 54-55 22.25 27.487499999999997 28.1375 22.125 56-57 21.4 29.212500000000002 27.6125 21.775 58-59 21.95 27.650000000000002 27.8375 22.5625 60-61 21.6625 28.237499999999997 28.349999999999998 21.75 62-63 21.85 28.9125 27.2625 21.975 64-65 21.55 27.9375 28.325 22.1875 66-67 23.11538942367796 26.690836354544317 27.54094261782723 22.652831603950492 68-69 22.0 28.175 27.487499999999997 22.3375 70-71 22.7125 27.0 28.175 22.112499999999997 72-73 21.215151893986747 28.216027003375423 28.378547318414803 22.190273784223027 74-75 21.6 27.5125 28.625 22.2625 76-77 21.6625 28.212500000000002 28.0625 22.0625 78-79 22.2625 27.474999999999998 28.1625 22.1 80-81 21.9375 28.1 28.225 21.7375 82-83 21.85 28.15 27.3625 22.6375 84-85 22.25 28.762500000000003 27.462500000000002 21.525 86-87 22.7125 27.787499999999998 27.0875 22.412499999999998 88-89 22.175 28.4 27.6375 21.7875 90-91 22.375 28.212500000000002 27.3625 22.05 92-93 22.325 28.6125 27.6375 21.425 94-95 22.8375 27.5625 27.787499999999998 21.8125 96-97 21.925 28.675 27.150000000000002 22.25 98-99 21.762500000000003 27.8375 28.4375 21.9625 100 22.705676419104776 27.781945486371594 27.731932983245812 21.780445111277817 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 4.0 26 3.0 27 3.0 28 6.5 29 11.5 30 17.0 31 24.5 32 37.5 33 49.0 34 62.5 35 82.5 36 102.5 37 126.0 38 150.0 39 168.0 40 197.0 41 219.5 42 235.0 43 253.5 44 261.0 45 254.0 46 230.5 47 213.0 48 205.0 49 184.0 50 155.5 51 128.0 52 115.0 53 103.0 54 81.5 55 64.5 56 46.0 57 40.0 58 36.5 59 30.0 60 23.5 61 17.5 62 12.0 63 6.5 64 6.0 65 6.5 66 4.5 67 2.5 68 1.0 69 1.5 70 3.0 71 3.0 72 2.0 73 1.5 74 2.5 75 1.5 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.8625 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.1875 48-49 1.4874999999999998 50-51 1.2625000000000002 52-53 0.1875 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97498749374687 99.925 2 0.0 0.0 3 0.02501250625312656 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593292 spots for SRR3207892.sra Written 1593292 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra Read 1593291 spots for SRR3207892.sra Written 1593291 spots for SRR3207892.sra SRR ids: ['SRR3207892.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6adyatbu SRR3207892.sra spots: 31865821 blocks: [[1, 1593291], [1593292, 3186582], [3186583, 4779873], [4779874, 6373164], [6373165, 7966455], [7966456, 9559746], [9559747, 11153037], [11153038, 12746328], [12746329, 14339619], [14339620, 15932910], [15932911, 17526201], [17526202, 19119492], [19119493, 20712783], [20712784, 22306074], [22306075, 23899365], [23899366, 25492656], [25492657, 27085947], [27085948, 28679238], [28679239, 30272529], [30272530, 31865821]] SRR3207892 file size 8281920 SRR3207892 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207892 SRR3207892_1.fastq Input file: SRR3207892_1.fastq trimmed: SRR3207892-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 13:25:03 2025 >> started Tue Feb 11 13:25:19 2025 >> done (16.029s) 31865821 reads processed; of these: 4635 ( 0.01%) short reads filtered out after trimming by size control 48569 ( 0.15%) empty reads filtered out after trimming by size control 31812617 (99.83%) reads available; of these: 1658411 ( 5.21%) trimmed reads available after processing 30154206 (94.79%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 645 0.00% 19 748 0.00% 20 912 0.00% 21 1200 0.00% 22 1570 0.00% 23 2120 0.01% 24 2687 0.01% 25 3538 0.01% 26 3878 0.01% 27 3701 0.01% 28 3673 0.01% 29 3800 0.01% 30 4098 0.01% 31 4017 0.01% 32 4147 0.01% 33 4448 0.01% 34 4623 0.01% 35 4971 0.02% 36 4931 0.02% 37 5581 0.02% 38 5818 0.02% 39 5837 0.02% 40 6180 0.02% 41 6846 0.02% 42 6434 0.02% 43 6811 0.02% 44 7161 0.02% 45 7655 0.02% 46 7793 0.02% 47 7807 0.02% 48 8867 0.03% 49 8667 0.03% 50 8614 0.03% 51 9188 0.03% 52 9285 0.03% 53 10610 0.03% 54 10735 0.03% 55 11517 0.04% 56 10331 0.03% 57 10588 0.03% 58 10926 0.03% 59 12111 0.04% 60 10486 0.03% 61 11412 0.04% 62 11821 0.04% 63 12647 0.04% 64 13301 0.04% 65 13971 0.04% 66 14898 0.05% 67 15542 0.05% 68 16981 0.05% 69 13770 0.04% 70 14140 0.04% 71 14738 0.05% 72 15516 0.05% 73 16289 0.05% 74 17311 0.05% 75 18498 0.06% 76 9589 0.03% 77 11288 0.04% 78 13667 0.04% 79 15225 0.05% 80 16622 0.05% 81 19071 0.06% 82 19195 0.06% 83 20967 0.07% 84 22680 0.07% 85 24815 0.08% 86 26692 0.08% 87 28077 0.09% 88 32788 0.10% 89 33553 0.11% 90 37882 0.12% 91 43168 0.14% 92 50720 0.16% 93 57354 0.18% 94 67021 0.21% 95 79660 0.25% 96 97318 0.31% 97 122932 0.39% 98 150882 0.47% 99 170855 0.54% 100 30154206 94.79% 31812617 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=60.33 fanout-score-rank=3 prefix-density=1.31 prefix-fanout=42.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=18 fanout-score=169.97 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=19.7 sequence=TCTTCTTCTTTGCTGCGCTCTCCGCTTATCTGCAGAACTCTTTGGCCCTCTTCCAACTCTATTTTCACCTCTTCCTTCTTCAAACCTGGAAGATCAGC Started job on | Feb 11 13:25:49 Started mapping on | Feb 11 13:25:49 Finished on | Feb 11 13:30:24 Mapping speed, Million of reads per hour | 416.46 Number of input reads | 31812617 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12444830 Uniquely mapped reads % | 39.12% Average mapped length | 98.40 Number of splices: Total | 3382823 Number of splices: Annotated (sjdb) | 3305332 Number of splices: GT/AG | 3326971 Number of splices: GC/AG | 44550 Number of splices: AT/AC | 4116 Number of splices: Non-canonical | 7186 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.06 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 370646 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 418072 % of reads mapped to too many loci | 1.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 58.36% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 18997141 18997141 18997141 N_multimapping 370646 370646 370646 N_noFeature 661369 6470456 6546754 N_ambiguous 136687 23905 24004 UnstrandedReadsAssigned:11646774 PositiveStrandReadsAssigned:5950469 NegativeStrandReadsAssigned:5874072 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207892 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207892-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,812,617 reads, 12,226,147 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR3207892.ke.tsv 34699 SRR3207892.se.tsv 87100 total ==> SRR3207892.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 879 51.8358 Potri.005G024800.1.v4.1 1035 936 907 109.66 Potri.004G059700.1.v4.1 961 862 32 4.20105 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 368.899 14.6789 Potri.016G087400.1.v4.1 270 171 401 265.377 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 74.6391 5.04576 Potri.012G127500.1.v4.1 977 878 1503 193.723 ==> SRR3207892.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1200 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207892 completed mapping pipeline successfully